Difference between revisions of "Pecten maximus"

From ICG
Jump to navigation Jump to search
 
(19 intermediate revisions by 5 users not shown)
Line 1: Line 1:
==Description==
+
=='''Description'''==
 
+
[[File:Pecten maximus.png|right|200px|link=Pecten maximus]]
[[File:Bivalve Mollusc-1.png|right|327px|]]
+
* '''''Pecten maximus''''' is a commercially important species in Europe. ''P. maximus'' is a simultaneous hermaphrodite, whose gonad consists of separate male and female parts. ''P. maximus'' displays a seasonal reproductive behavior in Galicia characteristic of many marine bivalves<ref name="ref1"/>.
* The king scallop Pecten maximus is a commercially important species in Europe. P. maximus is a simultaneous hermaphrodite, whose gonad consists of separate male and female parts. P. maximus displays a seasonal reproductive behavior in Galicia characteristic of many marine bivalves<ref name="ref1"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Great Scallop, King scallop'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6579 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Tissues'''''==
 
=='''''Different Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 12: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 54: Line 55:
 
|-
 
|-
 
|align="center"| gapdh<ref name="ref1"/>
 
|align="center"| gapdh<ref name="ref1"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
 
* Testis
 
* Testis
Line 78: Line 79:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 90: Line 91:
 
*'''Institution''': Departamento de Bioquímica y Biología Molecular, Instituto de Acuicultura, Universidad de Santiago de Compostela, C/ Constantino Candeira, s/n, 15782 Santiago de Compostela, Spain
 
*'''Institution''': Departamento de Bioquímica y Biología Molecular, Instituto de Acuicultura, Universidad de Santiago de Compostela, C/ Constantino Candeira, s/n, 15782 Santiago de Compostela, Spain
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''7''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=7752917638529032921&as_sdt=2005&sciodt=0,5&hl=en '''7'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 99: Line 100:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
  
 
[[Category:Animals]]
 
[[Category:Animals]]
Line 104: Line 106:
  
 
[[Category:SYBR]]
 
[[Category:SYBR]]
[[Category:18S rRNA]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:NADH]] [[Category:RPSA]]
+
[[Category:18S rRNA]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:NADH]] [[Category:RPS]]
 +
[[Category:Different Tissues]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 06:29, 1 September 2017

Description

Pecten maximus.png
  • Pecten maximus is a commercially important species in Europe. P. maximus is a simultaneous hermaphrodite, whose gonad consists of separate male and female parts. P. maximus displays a seasonal reproductive behavior in Galicia characteristic of many marine bivalves[1].
  • Common Name: Great Scallop, King scallop
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ndufa7[1] NADH dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 7
  • Ovary & testis
HE572783
  • F:ATTACACACGAGATGGACGCTG
  • R:ACATCAGAGCTGGCTGTTTCAG
115 60 SYBR
rpsa[1] 40S ribosomal protein SA
  • Ovary
HE572589
  • F:CTGGTCCGCAGCAGCTCCAG
  • R:ATGCCTATCCCCAGTTGTCAG
131 60 SYBR
ef1a[1] Eukaryotic translation elongation factor 1 alpha
  • Ovary
DN794050
  • F:AGGGCTCCTTCAAGTATGCCTG
  • R:TGAGCGGTCTCGAACTTCCAC
100 60 SYBR
gapdh[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Testis
DN794150
  • F:TCCGGATGTGTCTGTTGTTGAC
  • R:TTCAGATCTCCATCAGCTGCAC
102 60 SYBR
18S[1] 18S ribosomal RNA
  • Testis
L49053
  • F:TCGATGGTACGTGATATGCC
  • R:CGTTTCTCATGCTCCCTCTC
84 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Juan Pazos
  • Email: antonioj.pazos@usc.es
  • Institution: Departamento de Bioquímica y Biología Molecular, Instituto de Acuicultura, Universidad de Santiago de Compostela, C/ Constantino Candeira, s/n, 15782 Santiago de Compostela, Spain

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Mauriz O, Maneiro V, Pérez-Parallé M L, et al. Selection of reference genes for quantitative RT-PCR studies on the gonad of the bivalve mollusc Pecten maximus L[J]. Aquaculture, 2012, 370: 158-165.

Categories