Penicillium echinulatum

From ICG
Revision as of 07:23, 16 June 2017 by ICG Expert4 (talk | contribs) (Created page with "==Description== ==''''' Culture condition '''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! style...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Culture condition

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
actb[1] β-actin gene
  • Conditions to either induce (cellulose and sugar cane bagasse) or repress (glucose)
NA
  • F:AACTTCTCCTCGAAACCCTCCA
  • R:GTCGTGTACTGTGAGGTGCATACTT
NA NA SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Denise Zampieri
  • Email: denisezampi@hotmail.com
  • Institution: Institute of Biotechnology, University of Caxias do Sul, P.O. Box 1352, Caxias do Sul, RS 95070‐560, Brazil

References

  1. Zampieri D, Nora L C, Basso V, et al. Validation of reference genes in Penicillium echinulatum to enable gene expression study using real-time quantitative RT-PCR[J]. Current genetics, 2014, 60(3): 231-236.