Difference between revisions of "Pennisetum glaucum"

From ICG
Jump to navigation Jump to search
Line 53: Line 53:
 
*'''Email''': charulata14@gmail.com
 
*'''Email''': charulata14@gmail.com
 
*'''Institution''': CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow-226001, India.
 
*'''Institution''': CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow-226001, India.
 +
==Citation Statistics==
 +
Cited by '''12''' (Based on Google Scholar [2017-06-01])
  
 
=='''''Different Tissues & Genotypes '''''==
 
=='''''Different Tissues & Genotypes '''''==
Line 118: Line 120:
  
 
==Citation Statistics==
 
==Citation Statistics==
Cited by '''0''' (Based on Google Scholar [2017-06-01])
+
Cited by '''11''' (Based on Google Scholar [2017-06-01])
 
 
  
 
=='''References'''==
 
=='''References'''==

Revision as of 15:20, 19 June 2017

Description

REFqPCR2016016-1.jpg
  • Pearl millet [Pennisetum glaucum (L.) R. Br.] a widely used grain and forage crop, is grown in areas frequented with one or more abiotic stresses, has superior drought and heat tolerance and considered a model crop for stress tolerance studies. It usually thrive in areas with scanty rainfall and is also well adapted to various abiotic stresses such as drought, high temperature, salinity etc. whether occurring individually or in combination making it an ideal crop for functional genomic studies to understand the molecular basis of abiotic stress tolerance and adaptation.
  • Pearl millet [Pennisetum glaucum (L.) R. Br.] is an important small-grained C 4 panicoid crop grown for forage, grain and stover in the arid and semi-arid regions of Asia and Africa. It is the sixth most important cereal crops after rice, wheat, maize, barley and sorghum with excellent nutrient composition and is also considered a potential biofuel grain feedstock; http://ag.fvsu.edu/index.php/research/bioenergy/). [1] [2].

Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF-1α[2] Elongation factor-1 alpha,partial cds.
  • Universal reference gene
EF694165
  • F:GTTACAACCCAGACAAGATTGC
  • R:GTTACAACCCAGACAAGATTGC
72 60 SYBR
UBC-E2[2] Ubiquitin-conjugating enzyme E2.
  • Universal reference gene
CD724586
  • F:ACCGCCTGACAATCCCTATG
  • R:ACCGCCTGACAATCCCTATG
119 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Radha Shivhare
  • Email: charulata14@gmail.com
  • Institution: CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow-226001, India.

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-06-01])

Different Tissues & Genotypes

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF-1α[3] elongation factor 1 subunit alpha (EF1-alpha)
  • Different plant tissues
EF694165
  • F:AATGATCCGCTGCTGTAACAAG
  • R:AATGATCCGCTGCTGTAACAAG
128 83.3 SYBR
EIF4A[3] Eukaryotic initiation factor 4A
  • Different plant tissues & abiotic stress conditions
EU856535
  • F:ATCGTGAGCTTTACATCCATCG
  • R:ATCGTGAGCTTTACATCCATCG
105 85.3 SYBR
UBC[3] Ubiquitin-conjugating enzyme
  • Different Genotypes
CD724586
  • F:TTCAAACCTCCGAAGGTGTCTT
  • R:TTCAAACCTCCGAAGGTGTCTT
100 80.1 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Palakolanu Sudhakar Reddy
  • Email: p.sudhakarreddy@cgiar.org
  • Institution: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Hyderabad 502 324, Telangana, India

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-06-01])

References

  1. Adebiyi JA, Obadina AO, Adebo OA, Kayitesi E (2017) Comparison of nutritional quality and sensory acceptability of biscuits obtained from native, fermented, and malted pearl millet (Pennisetum glaucum) flour. Food Chem 232, 210-217.
  2. 2.0 2.1 2.2 Shivhare R, Lata C (2016) Selection of suitable reference genes for assessing gene expression in pearl millet under different abiotic stresses and their combinations. Sci Rep 6, 23036.
  3. 3.0 3.1 3.2 Reddy P S, Reddy D S, Sharma K K, et al. Cloning and validation of reference genes for normalization of gene expression studies in pearl millet [Pennisetum glaucum (L.) R. Br.] by quantitative real-time PCR[J]. Plant Gene, 2015, 1: 35-42.