Difference between revisions of "Pennisetum glaucum"

From ICG
Jump to navigation Jump to search
 
(26 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
−
[[File:REFqPCR2016016-1.jpg|right|327px|]]
+
[[File:Pennisetum glaucum.png|right|200px|link=Pennisetum glaucum]]
−
* Pearl millet [Pennisetum glaucum (L.) R. Br.] a widely used grain and forage crop, is grown in areas frequented with one or more abiotic stresses, has superior drought and heat tolerance and considered a model crop for stress tolerance studies. It usually thrive in areas with scanty rainfall and is also well adapted to various abiotic stresses such as drought, high temperature, salinity etc. whether occurring individually or in combination making it an ideal crop for functional genomic studies to understand the molecular basis of abiotic stress tolerance and adaptation.
+
* '''''Pennisetum glaucum''''' is widely used small-grained C4 panicoid crop grown for forage, grain and stover with excellent nutrient composition in the arid and semi-arid regions of Asia and Africa. It is also considered a potential biofuel grain feedstock which is grown in areas frequented with one or more abiotic stresses. The superior drought and heat tolerance make it an model crop for functional genomic studies to understand the molecular basis of abiotic stress tolerance and adaptation<ref name="ref1"/> <ref name="ref2"/>.
−
* Pearl millet [Pennisetum glaucum (L.) R. Br.] is an important small-grained C 4 panicoid crop grown for forage, grain and stover in the arid and semi-arid regions of Asia and Africa. It is the sixth most important cereal crops after rice, wheat, maize, barley and sorghum with excellent nutrient composition and is also considered a potential biofuel grain feedstock; http://ag.fvsu.edu/index.php/research/bioenergy/). <ref name="ref1"/> <ref name="ref2"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Pearl millet'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4543 <font color=blue>'''NCBI Taxonomy'''</font>]
  
−
=='''''Different Abiotic Stresses'''''==
+
=='''''Abiotic Stress'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 12: Line 13:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
 
! Detection
 
! Detection
 
|-
 
|-
−
|align="center"| EF-1α<ref name="ref1"/>
+
|align="center"| EF-1α<ref name="ref2"/>
−
|align="center"| Elongation factor-1 alpha,partial cds.
+
|align="center"| Elongation factor-1 alpha
 
|
 
|
−
* Universal reference gene
+
* Leaf, stem, stem sheath, root, panicle at booting stage and grain filling stages, and seeds
 +
* Drought, salt, heat, cold
 +
* ABA
 +
* Different developmental stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF694165 '''EF694165''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF694165 '''EF694165''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GTTACAACCCAGACAAGATTGC
 
* F:GTTACAACCCAGACAAGATTGC
−
* R:GTTACAACCCAGACAAGATTGC
+
* R:TGGACCTCTCAATCGTGTTG
 
|align="center"|  72  
 
|align="center"|  72  
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
−
|align="center"| UBC-E2<ref name="ref1"/>
+
|align="center"| UBC-E2<ref name="ref2"/>
−
|align="center"| Ubiquitin-conjugating enzyme E2.
+
|align="center"| Ubiquitin-conjugating enzyme E2
 
|
 
|
−
* Universal reference gene
+
* Leaf, stem, stem sheath, root, panicle at booting stage and grain filling stages, and seeds
 +
* Drought, salt, heat, cold
 +
* ABA
 +
* Different developmental stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CD724586 '''CD724586''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CD724586 '''CD724586''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ACCGCCTGACAATCCCTATG
 
* F:ACCGCCTGACAATCCCTATG
−
* R:ACCGCCTGACAATCCCTATG
+
* R:GGGATAGTCTGGCGGAAAATG
 
|align="center"|  119  
 
|align="center"|  119  
 
|align="center"| 60
 
|align="center"| 60
Line 42: Line 49:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 53: Line 60:
 
*'''Email''': charulata14@gmail.com
 
*'''Email''': charulata14@gmail.com
 
*'''Institution''': CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow-226001, India.
 
*'''Institution''': CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow-226001, India.
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=7508598158674022951&as_sdt=2005&sciodt=0,5&hl=en'''16'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Different Tissues & Genotypes '''''==
 
=='''''Different Tissues & Genotypes '''''==
  
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 63: Line 72:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 69: Line 78:
 
|-
 
|-
 
|align="center"| EF-1α<ref name="ref3"/>
 
|align="center"| EF-1α<ref name="ref3"/>
−
|align="center"| elongation factor 1 subunit alpha (EF1-alpha)
+
|align="center"| Elongation factor 1 subunit alpha
 
|
 
|
 
* Different plant tissues  
 
* Different plant tissues  
Line 75: Line 84:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AATGATCCGCTGCTGTAACAAG
 
* F:AATGATCCGCTGCTGTAACAAG
−
* R:AATGATCCGCTGCTGTAACAAG
+
* R:AGGCAATCTTGTCTGGGTTGTA
 
|align="center"|  128  
 
|align="center"|  128  
 
|align="center"| 83.3
 
|align="center"| 83.3
Line 87: Line 96:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ATCGTGAGCTTTACATCCATCG
 
* F:ATCGTGAGCTTTACATCCATCG
−
* R:ATCGTGAGCTTTACATCCATCG
+
* R:TATCCCTCAGGATACGGATGTC
 
|align="center"|  105  
 
|align="center"|  105  
 
|align="center"| 85.3
 
|align="center"| 85.3
Line 99: Line 108:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TTCAAACCTCCGAAGGTGTCTT
 
* F:TTCAAACCTCCGAAGGTGTCTT
−
* R:TTCAAACCTCCGAAGGTGTCTT
+
* R:GGCTCCACTGCTCTTTAAGAATG
 
|align="center"|  100  
 
|align="center"|  100  
 
|align="center"| 80.1
 
|align="center"| 80.1
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
−
===Moleculer Types===
+
 
 +
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 117: Line 127:
 
*'''Institution''': International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Hyderabad 502 324, Telangana, India
 
*'''Institution''': International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Hyderabad 502 324, Telangana, India
  
−
==Citation Statistics==
+
===Citation Statistics===
−
Cited by '''0''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=4399585893020178752&as_sdt=2005&sciodt=0,5&hl=en'''11'''] (Based on Google Scholar [2017-09-01])
−
 
 
  
 
=='''References'''==
 
=='''References'''==
Line 133: Line 142:
 
</ref>
 
</ref>
 
</references>
 
</references>
−
 
+
=='''Categories'''==
−
[[Category:Plants]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:EF1α]][[Category:EF1α]][[Category:eIF]][[Category:Ubiquitin]][[Category:Ubiquitin]][[Category:Different Genotypes]][[Category:Different Tissues]][[Category:Abiotic Stress]][[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]][[Category:RefFinder]]

Latest revision as of 07:18, 1 September 2017

Description

Pennisetum glaucum.png
  • Pennisetum glaucum is widely used small-grained C4 panicoid crop grown for forage, grain and stover with excellent nutrient composition in the arid and semi-arid regions of Asia and Africa. It is also considered a potential biofuel grain feedstock which is grown in areas frequented with one or more abiotic stresses. The superior drought and heat tolerance make it an model crop for functional genomic studies to understand the molecular basis of abiotic stress tolerance and adaptation[1] [2].
  • Common Name: Pearl millet
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
EF-1α[2] Elongation factor-1 alpha
  • Leaf, stem, stem sheath, root, panicle at booting stage and grain filling stages, and seeds
  • Drought, salt, heat, cold
  • ABA
  • Different developmental stages
 EF694165
  • F:GTTACAACCCAGACAAGATTGC
  • R:TGGACCTCTCAATCGTGTTG
 72 60 SYBR
UBC-E2[2] Ubiquitin-conjugating enzyme E2
  • Leaf, stem, stem sheath, root, panicle at booting stage and grain filling stages, and seeds
  • Drought, salt, heat, cold
  • ABA
  • Different developmental stages
 CD724586
  • F:ACCGCCTGACAATCCCTATG
  • R:GGGATAGTCTGGCGGAAAATG
 119 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Radha Shivhare
  • Email: charulata14@gmail.com
  • Institution: CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow-226001, India.

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-09-01])

Different Tissues & Genotypes

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
EF-1α[3] Elongation factor 1 subunit alpha
  • Different plant tissues
 EF694165
  • F:AATGATCCGCTGCTGTAACAAG
  • R:AGGCAATCTTGTCTGGGTTGTA
 128 83.3 SYBR
EIF4A[3] Eukaryotic initiation factor 4A
  • Different plant tissues & abiotic stress conditions
 EU856535
  • F:ATCGTGAGCTTTACATCCATCG
  • R:TATCCCTCAGGATACGGATGTC
 105 85.3 SYBR
UBC[3] Ubiquitin-conjugating enzyme
  • Different Genotypes
 CD724586
  • F:TTCAAACCTCCGAAGGTGTCTT
  • R:GGCTCCACTGCTCTTTAAGAATG
 100 80.1 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Palakolanu Sudhakar Reddy
  • Email: p.sudhakarreddy@cgiar.org
  • Institution: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Hyderabad 502 324, Telangana, India

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-09-01])

References

  1. ↑ Adebiyi JA, Obadina AO, Adebo OA, Kayitesi E (2017) Comparison of nutritional quality and sensory acceptability of biscuits obtained from native, fermented, and malted pearl millet (Pennisetum glaucum) flour. Food Chem 232, 210-217.
  2. ↑ 2.0 2.1 2.2 Shivhare R, Lata C (2016) Selection of suitable reference genes for assessing gene expression in pearl millet under different abiotic stresses and their combinations. Sci Rep 6, 23036.
  3. ↑ 3.0 3.1 3.2 Reddy P S, Reddy D S, Sharma K K, et al. Cloning and validation of reference genes for normalization of gene expression studies in pearl millet [Pennisetum glaucum (L.) R. Br.] by quantitative real-time PCR[J]. Plant Gene, 2015, 1: 35-42.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Pennisetum_glaucum&oldid=8752"