Difference between revisions of "Pennisetum glaucum"
Jump to navigation
Jump to search
Line 79: | Line 79: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AATGATCCGCTGCTGTAACAAG | * F:AATGATCCGCTGCTGTAACAAG | ||
− | * R: | + | * R:AGGCAATCTTGTCTGGGTTGTA |
|align="center"| 128 | |align="center"| 128 | ||
|align="center"| 83.3 | |align="center"| 83.3 | ||
Line 91: | Line 91: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:ATCGTGAGCTTTACATCCATCG | * F:ATCGTGAGCTTTACATCCATCG | ||
− | * R: | + | * R:TATCCCTCAGGATACGGATGTC |
|align="center"| 105 | |align="center"| 105 | ||
|align="center"| 85.3 | |align="center"| 85.3 | ||
Line 103: | Line 103: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TTCAAACCTCCGAAGGTGTCTT | * F:TTCAAACCTCCGAAGGTGTCTT | ||
− | * R: | + | * R:GGCTCCACTGCTCTTTAAGAATG |
|align="center"| 100 | |align="center"| 100 | ||
|align="center"| 80.1 | |align="center"| 80.1 |
Revision as of 02:05, 23 June 2017
Contents
Description
- Pearl millet [Pennisetum glaucum (L.) R. Br.] a widely used grain and forage crop, is grown in areas frequented with one or more abiotic stresses, has superior drought and heat tolerance and considered a model crop for stress tolerance studies. It usually thrive in areas with scanty rainfall and is also well adapted to various abiotic stresses such as drought, high temperature, salinity etc. whether occurring individually or in combination making it an ideal crop for functional genomic studies to understand the molecular basis of abiotic stress tolerance and adaptation.
- Pearl millet [Pennisetum glaucum (L.) R. Br.] is an important small-grained C 4 panicoid crop grown for forage, grain and stover in the arid and semi-arid regions of Asia and Africa. It is the sixth most important cereal crops after rice, wheat, maize, barley and sorghum with excellent nutrient composition and is also considered a potential biofuel grain feedstock; http://ag.fvsu.edu/index.php/research/bioenergy/). [1] [2].
- Common Name: Pearl millet
- NCBI Taxonomy
Abiotic Stress
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
EF-1α[2] | Elongation factor-1 alpha,partial cds. |
|
EF694165 |
|
72 | 60 | SYBR |
UBC-E2[2] | Ubiquitin-conjugating enzyme E2. |
|
CD724586 |
|
119 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- Ref-Finder method && Related Reference
Contact
- Name: Radha Shivhare
- Email: charulata14@gmail.com
- Institution: CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow-226001, India.
Citation Statistics
Cited by 12 (Based on Google Scholar [2017-06-01])
Different Tissues & Genotypes
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
EF-1α[3] | Elongation factor 1 subunit alpha (EF1-alpha) |
|
EF694165 |
|
128 | 83.3 | SYBR |
EIF4A[3] | Eukaryotic initiation factor 4A |
|
EU856535 |
|
105 | 85.3 | SYBR |
UBC[3] | Ubiquitin-conjugating enzyme |
|
CD724586 |
|
100 | 80.1 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
Contact
- Name: Palakolanu Sudhakar Reddy
- Email: p.sudhakarreddy@cgiar.org
- Institution: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Hyderabad 502 324, Telangana, India
Citation Statistics
Cited by 11 (Based on Google Scholar [2017-06-01])
References
- ↑ Adebiyi JA, Obadina AO, Adebo OA, Kayitesi E (2017) Comparison of nutritional quality and sensory acceptability of biscuits obtained from native, fermented, and malted pearl millet (Pennisetum glaucum) flour. Food Chem 232, 210-217.
- ↑ 2.0 2.1 2.2 Shivhare R, Lata C (2016) Selection of suitable reference genes for assessing gene expression in pearl millet under different abiotic stresses and their combinations. Sci Rep 6, 23036.
- ↑ 3.0 3.1 3.2 Reddy P S, Reddy D S, Sharma K K, et al. Cloning and validation of reference genes for normalization of gene expression studies in pearl millet [Pennisetum glaucum (L.) R. Br.] by quantitative real-time PCR[J]. Plant Gene, 2015, 1: 35-42.