Difference between revisions of "Pennisetum glaucum"

From ICG
Jump to navigation Jump to search
Line 61: Line 61:
 
*'''Institution''': CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow-226001, India.
 
*'''Institution''': CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow-226001, India.
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''12''' (Based on Google Scholar [2017-06-01])
+
Cited by '''15''' (Based on Google Scholar [2017-08-10])
  
 
=='''''Different Tissues & Genotypes '''''==
 
=='''''Different Tissues & Genotypes '''''==

Revision as of 08:48, 11 August 2017

Description

Pennisetum glaucum.png
  • Pennisetum glaucum is widely used small-grained C4 panicoid crop grown for forage, grain and stover with excellent nutrient composition in the arid and semi-arid regions of Asia and Africa. It is also considered a potential biofuel grain feedstock which is grown in areas frequented with one or more abiotic stresses. The superior drought and heat tolerance make it an model crop for functional genomic studies to understand the molecular basis of abiotic stress tolerance and adaptation[1] [2].
  • Common Name: Pearl millet
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF-1α[2] Elongation factor-1 alpha
  • Leaf, stem, stem sheath, root, panicle at booting stage and grain filling stages, and seeds
  • Drought, salt, heat, cold
  • ABA
  • Different developmental stages
EF694165
  • F:GTTACAACCCAGACAAGATTGC
  • R:TGGACCTCTCAATCGTGTTG
72 60 SYBR
UBC-E2[2] Ubiquitin-conjugating enzyme E2
  • Leaf, stem, stem sheath, root, panicle at booting stage and grain filling stages, and seeds
  • Drought, salt, heat, cold
  • ABA
  • Different developmental stages
CD724586
  • F:ACCGCCTGACAATCCCTATG
  • R:GGGATAGTCTGGCGGAAAATG
119 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Radha Shivhare
  • Email: charulata14@gmail.com
  • Institution: CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow-226001, India.

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-08-10])

Different Tissues & Genotypes

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF-1α[3] Elongation factor 1 subunit alpha
  • Different plant tissues
EF694165
  • F:AATGATCCGCTGCTGTAACAAG
  • R:AGGCAATCTTGTCTGGGTTGTA
128 83.3 SYBR
EIF4A[3] Eukaryotic initiation factor 4A
  • Different plant tissues & abiotic stress conditions
EU856535
  • F:ATCGTGAGCTTTACATCCATCG
  • R:TATCCCTCAGGATACGGATGTC
105 85.3 SYBR
UBC[3] Ubiquitin-conjugating enzyme
  • Different Genotypes
CD724586
  • F:TTCAAACCTCCGAAGGTGTCTT
  • R:GGCTCCACTGCTCTTTAAGAATG
100 80.1 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Palakolanu Sudhakar Reddy
  • Email: p.sudhakarreddy@cgiar.org
  • Institution: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Hyderabad 502 324, Telangana, India

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-06-01])

References

  1. Adebiyi JA, Obadina AO, Adebo OA, Kayitesi E (2017) Comparison of nutritional quality and sensory acceptability of biscuits obtained from native, fermented, and malted pearl millet (Pennisetum glaucum) flour. Food Chem 232, 210-217.
  2. 2.0 2.1 2.2 Shivhare R, Lata C (2016) Selection of suitable reference genes for assessing gene expression in pearl millet under different abiotic stresses and their combinations. Sci Rep 6, 23036.
  3. 3.0 3.1 3.2 Reddy P S, Reddy D S, Sharma K K, et al. Cloning and validation of reference genes for normalization of gene expression studies in pearl millet [Pennisetum glaucum (L.) R. Br.] by quantitative real-time PCR[J]. Plant Gene, 2015, 1: 35-42.

Categories