Difference between revisions of "Peucedanum praeruptorum"

From ICG
Jump to navigation Jump to search
 
(19 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2017010-1.jpg|right|327px|]]
+
[[File:Peucedanum praeruptorum.png|right|200px|link=Peucedanum praeruptorum]]
* Peucedanum praeruptorum Dunn is one of the main traditional Chinese medicines producing coumarins and plenty of literatures are focused on the biosynthesis of coumarins.
+
* '''''Peucedanum praeruptorum''''' is a popular Chinese herb that is frequently used in many traditional herbal remedies. Its main medicinal part is the root that produce coumarins. As a vital medicine to help cough up mucus, it is commonly used in the treatment of ailments that are associated with the symptoms of coughing and phlegm. What’s more, it can be also used in dysentery, chronic enteritis, chronic obstructive pulmonary disease with secondary pulmonary hypertension, baby crying at night for no reason, furuncle, and so on.<ref name="ref1"/> <ref name="ref2"/>.
* Peucedanum, also known as Qian Hu in Pinyin, is a popular Chinese herb that is frequently used in many traditional herbal remedies. Its main medicinal part is the root. As a vital medicine to help cough up mucus, in particular yellow mucus, it is commonly used in the treatment of ailments that are associated with the symptoms of coughing and phlegm, such as cough after cold, acute and chronic bronchitis, viral influenza, pneumonia, etc. What’s more, today it can be also used in dysentery, chronic enteritis, chronic obstructive pulmonary disease with secondary pulmonary hypertension, baby crying at night for no reason, furuncle, and so on.<ref name="ref1"/> <ref name="ref2"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Qian Hu'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=312531 <font color=blue>'''NCBI Taxonomy'''</font>]
  
=='''''Abiotic Stresses, Hormone Treatments and Different Tissues'''''==
+
=='''''Abiotic Stresses Hormone Treatment & Different Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 12: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 20: Line 21:
 
|align="center"| SAND family protein
 
|align="center"| SAND family protein
 
|
 
|
* NaCl,MeJA,SA,Cold stress
+
* NaCl,MeJA,SA,cold stress
 
|align="center"| NA (from Unpublic Transcriptome Data)   
 
|align="center"| NA (from Unpublic Transcriptome Data)   
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ACAGAAGAGCCTCATGAATCCC
 
* F:ACAGAAGAGCCTCATGAATCCC
* R:ACAGAAGAGCCTCATGAATCCC
+
* R:CAAGCAAAGGCGTCATATCAAA
 
|align="center"|  98  
 
|align="center"|  98  
 
|align="center"| 60
 
|align="center"| 60
Line 36: Line 37:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TTTCACTATATGCCAGTGGTCG
 
* F:TTTCACTATATGCCAGTGGTCG
* R:TTTCACTATATGCCAGTGGTCG
+
* R:CTTCGTAGATCGGGACAGTGTG
 
|align="center"|  84  
 
|align="center"|  84  
 
|align="center"| 60
 
|align="center"| 60
Line 48: Line 49:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CTCGAAGCGGATCTTGAAGGAG
 
* F:CTCGAAGCGGATCTTGAAGGAG
* R:CTCGAAGCGGATCTTGAAGGAG
+
* R:CACCCGCATATGGACTGTCAGG
 
|align="center"|  137  
 
|align="center"|  137  
 
|align="center"| 60
 
|align="center"| 60
Line 54: Line 55:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 66: Line 67:
 
*'''Institution''': State Key Laboratory of Natural Medicines, Department of Natural Medicinal Chemistry, China Pharmaceutical University, Nanjing, Jiangsu, P. R. China,
 
*'''Institution''': State Key Laboratory of Natural Medicines, Department of Natural Medicinal Chemistry, China Pharmaceutical University, Nanjing, Jiangsu, P. R. China,
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''5''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=9485026512399829383&as_sdt=2005&sciodt=0,5&hl=en'''4'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Purohit GK, Mahanty A, Mohanty BP, Mohanty S (2016) Evaluation of housekeeping genes as references for quantitative real-time PCR analysis of gene expression in the murrel Channa striatus under high-temperature stress. Fish Physiol Biochem 42, 125-135.
+
Zhao Y, Luo J, Xu S, et al. Selection of reference genes for gene expression normalization in Peucedanum praeruptorum dunn under abiotic stresses, hormone treatments and different tissues[J]. PloS one, 2016, 11(3): e0152356.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Line 79: Line 80:
 
</references>
 
</references>
  
[[Category:Plants]]
+
=='''Categories'''==
 +
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]][[Category:SAND]][[Category:Ubiquitin]][[Category:Hormone Treatment]][[Category:Different Tissues]]  [[Category:Abiotic Stress]][[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]]

Latest revision as of 07:19, 1 September 2017

Description

Peucedanum praeruptorum.png
  • Peucedanum praeruptorum is a popular Chinese herb that is frequently used in many traditional herbal remedies. Its main medicinal part is the root that produce coumarins. As a vital medicine to help cough up mucus, it is commonly used in the treatment of ailments that are associated with the symptoms of coughing and phlegm. What’s more, it can be also used in dysentery, chronic enteritis, chronic obstructive pulmonary disease with secondary pulmonary hypertension, baby crying at night for no reason, furuncle, and so on.[1] [2].
  • Common Name: Qian Hu
  • NCBI Taxonomy

Abiotic Stresses & Hormone Treatment & Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SAND[1] SAND family protein
  • NaCl,MeJA,SA,cold stress
NA (from Unpublic Transcriptome Data)
  • F:ACAGAAGAGCCTCATGAATCCC
  • R:CAAGCAAAGGCGTCATATCAAA
98 60 SYBR
ACT2[1] Actin 2
  • H2O2 and hot stress
NA (from Unpublic Transcriptome Data)
  • F:TTTCACTATATGCCAGTGGTCG
  • R:CTTCGTAGATCGGGACAGTGTG
84 60 SYBR
UBC9[1] Ubiquitin-conjugating enzyme 9
  • CuSO4 stress
NA (from Unpublic Transcriptome Data)
  • F:CTCGAAGCGGATCTTGAAGGAG
  • R:CACCCGCATATGGACTGTCAGG
137 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Lingyi Kong
  • Email: cpu_lykong@126.com
  • Institution: State Key Laboratory of Natural Medicines, Department of Natural Medicinal Chemistry, China Pharmaceutical University, Nanjing, Jiangsu, P. R. China,

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Zhao Y, Luo J, Xu S, et al. Selection of reference genes for gene expression normalization in Peucedanum praeruptorum dunn under abiotic stresses, hormone treatments and different tissues[J]. PloS one, 2016, 11(3): e0152356.
  2. Kang A, Xie T, Zhu D, et al. (2017) Comparative pharmacokinetic study of pyranocoumarins and khellactone in normal and acute lung injury rats after oral administration of Peucedanum praeruptorum Dunn extracts using a rapid and sensitive liquid chromatography-tandem mass spectrometry method. Biomedical chromatography : BMC.

Categories