Difference between revisions of "Peucedanum praeruptorum"

From ICG
Jump to navigation Jump to search
Line 80: Line 80:
  
 
[[Category:Plants]]
 
[[Category:Plants]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:24, 19 June 2017

Description

REFqPCR2017010-1.jpg
  • Peucedanum praeruptorum Dunn is one of the main traditional Chinese medicines producing coumarins and plenty of literatures are focused on the biosynthesis of coumarins.
  • Peucedanum, also known as Qian Hu in Pinyin, is a popular Chinese herb that is frequently used in many traditional herbal remedies. Its main medicinal part is the root. As a vital medicine to help cough up mucus, in particular yellow mucus, it is commonly used in the treatment of ailments that are associated with the symptoms of coughing and phlegm, such as cough after cold, acute and chronic bronchitis, viral influenza, pneumonia, etc. What’s more, today it can be also used in dysentery, chronic enteritis, chronic obstructive pulmonary disease with secondary pulmonary hypertension, baby crying at night for no reason, furuncle, and so on.[1] [2].

Abiotic Stresses, Hormone Treatments and Different Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SAND[1] SAND family protein
  • NaCl,MeJA,SA,cold stress
NA (from Unpublic Transcriptome Data)
  • F:ACAGAAGAGCCTCATGAATCCC
  • R:ACAGAAGAGCCTCATGAATCCC
98 60 SYBR
ACT2[1] Actin 2
  • H2O2 and hot stress
NA (from Unpublic Transcriptome Data)
  • F:TTTCACTATATGCCAGTGGTCG
  • R:TTTCACTATATGCCAGTGGTCG
84 60 SYBR
UBC9[1] Ubiquitin-conjugating enzyme 9
  • CuSO4 stress
NA (from Unpublic Transcriptome Data)
  • F:CTCGAAGCGGATCTTGAAGGAG
  • R:CTCGAAGCGGATCTTGAAGGAG
137 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Lingyi Kong
  • Email: cpu_lykong@126.com
  • Institution: State Key Laboratory of Natural Medicines, Department of Natural Medicinal Chemistry, China Pharmaceutical University, Nanjing, Jiangsu, P. R. China,

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Purohit GK, Mahanty A, Mohanty BP, Mohanty S (2016) Evaluation of housekeeping genes as references for quantitative real-time PCR analysis of gene expression in the murrel Channa striatus under high-temperature stress. Fish Physiol Biochem 42, 125-135.
  2. Kang A, Xie T, Zhu D, et al. (2017) Comparative pharmacokinetic study of pyranocoumarins and khellactone in normal and acute lung injury rats after oral administration of Peucedanum praeruptorum Dunn extracts using a rapid and sensitive liquid chromatography-tandem mass spectrometry method. Biomedical chromatography : BMC.