Difference between revisions of "Phaseolus vulgaris"

From ICG
Jump to navigation Jump to search
Line 3: Line 3:
 
[[File:Phaseolus vulgaris-1.png|right|327px|]]
 
[[File:Phaseolus vulgaris-1.png|right|327px|]]
 
* Common bean is the most important legume for direct human consumption, providing an important source of minerals and proteins. Worldwide,common bean is the most consumed legume, providing up to 15% of total daily calories and 36% of total daily protein in parts of Africa and the Americas (see URLs). More than 200 million people in subSaharan Africa depend on the common bean as a primary staple. It has many health-beneficial, nutrients whose concentrations are heritable, and increasing the concentrations of these nutrients is abreeding objective worldwide.Multiple lines of evidence have shown that wild common bean is organized in two geographically isolated and genetically differentiated wild gene pools (Mesoamerican and Andean) that diverged from a common ancestral wild population more than 100,000 years ago. From these wild gene pools, nearly 8,000 years ago, common bean was independently domesticated in what is now Mexico and in South America, and these domestication events were followed by local adaptations resulting in landraces with distinct characteristics<ref name="ref1"/> <ref name="ref2"/>.
 
* Common bean is the most important legume for direct human consumption, providing an important source of minerals and proteins. Worldwide,common bean is the most consumed legume, providing up to 15% of total daily calories and 36% of total daily protein in parts of Africa and the Americas (see URLs). More than 200 million people in subSaharan Africa depend on the common bean as a primary staple. It has many health-beneficial, nutrients whose concentrations are heritable, and increasing the concentrations of these nutrients is abreeding objective worldwide.Multiple lines of evidence have shown that wild common bean is organized in two geographically isolated and genetically differentiated wild gene pools (Mesoamerican and Andean) that diverged from a common ancestral wild population more than 100,000 years ago. From these wild gene pools, nearly 8,000 years ago, common bean was independently domesticated in what is now Mexico and in South America, and these domestication events were followed by local adaptations resulting in landraces with distinct characteristics<ref name="ref1"/> <ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''String bean''', '''Bean''', '''Common Bean'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3885 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Biotic & Abiotic Stresses'''''==
 
=='''''Biotic & Abiotic Stresses'''''==

Revision as of 01:46, 25 June 2017

Description

Phaseolus vulgaris-1.png
  • Common bean is the most important legume for direct human consumption, providing an important source of minerals and proteins. Worldwide,common bean is the most consumed legume, providing up to 15% of total daily calories and 36% of total daily protein in parts of Africa and the Americas (see URLs). More than 200 million people in subSaharan Africa depend on the common bean as a primary staple. It has many health-beneficial, nutrients whose concentrations are heritable, and increasing the concentrations of these nutrients is abreeding objective worldwide.Multiple lines of evidence have shown that wild common bean is organized in two geographically isolated and genetically differentiated wild gene pools (Mesoamerican and Andean) that diverged from a common ancestral wild population more than 100,000 years ago. From these wild gene pools, nearly 8,000 years ago, common bean was independently domesticated in what is now Mexico and in South America, and these domestication events were followed by local adaptations resulting in landraces with distinct characteristics[1] [2].
  • Common Name: String bean, Bean, Common Bean
  • NCBI Taxonomy

Biotic & Abiotic Stresses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
IDE[1] Insulin degrading enzyme
  • Biotic stress analysis
171614244
  • F:GCAACCAACCTTTCATCAGC
  • R:AGAAATGCCTCAACCCTTTG
156 81.1 SYBR
Act11[1] Actin-11
  • Biotic & abiotic stress
62703083
  • F:TGCATACGTTGGTGATGAGG
  • R:AGCCTTGGGGTTAAGAGGAG
190 79.4 SYBR
Skip16[1] SKP1/ASK-interacting protein 16
  • Abiotic stress
187434529
  • F:CACCAGGATGCAAAAGTGG
  • R:ATCCGCTTGTCCCTTGAAC
163 81.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Danielle Gregorio Gomes Caldas
  • Email: dcaldas@cena.usp.br
  • Institution: Center of Nuclear Energy for Agriculture, Laboratory of Cellular and Molecular Biology, University of São Paulo, P. O. Box 96 CEP, Piracicaba, SP 13400-970, Brazil

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Koči J, Šimo L, Park Y. Validation of internal reference genes for real-time quantitative polymerase chain reaction studies in the tick, Ixodes scapularis (Acari: Ixodidae)[J]. Journal of medical entomology, 2013, 50(1): 79-84.
  2. Schmutz J, McClean P E, Mamidi S, et al. A reference genome for common bean and genome-wide analysis of dual domestications[J]. Nature genetics, 2014, 46(7): 707-713.