Phaseolus vulgaris

Description

Common bean is the most important legume for direct human consumption, providing an important source of minerals and proteins. Worldwide,common bean is the most consumed legume, providing up to 15% of total daily calories and 36% of total daily protein in parts of Africa and the Americas (see URLs). More than 200 million people in subSaharan Africa depend on the common bean as a primary staple. It has many health-beneficial, nutrients whose concentrations are heritable, and increasing the concentrations of these nutrients is abreeding objective worldwide.Multiple lines of evidence have shown that wild common bean is organized in two geographically isolated and genetically differentiated wild gene pools (Mesoamerican and Andean) that diverged from a common ancestral wild population more than 100,000 years ago. From these wild gene pools, nearly 8,000 years ago, common bean was independently domesticated in what is now Mexico and in South America, and these domestication events were followed by local adaptations resulting in landraces with distinct characteristics^[1] ^[2].
Common Name: String bean, Bean, Common Bean
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
IDE^[1]	Insulin degrading enzyme	Biotic stress analysis	171614244	F:GCAACCAACCTTTCATCAGC R:AGAAATGCCTCAACCCTTTG	156	81.1	SYBR
Act11^[1]	Actin-11	Biotic & abiotic stress	62703083	F:TGCATACGTTGGTGATGAGG R:AGCCTTGGGGTTAAGAGGAG	190	79.4	SYBR
Skip16^[1]	SKP1/ASK-interacting protein 16	Abiotic stress	187434529	F:CACCAGGATGCAAAAGTGG R:ATCCGCTTGTCCCTTGAAC	163	81.5	SYBR

Name: Danielle Gregorio Gomes Caldas
Email: dcaldas@cena.usp.br
Institution: Center of Nuclear Energy for Agriculture, Laboratory of Cellular and Molecular Biology, University of São Paulo, P. O. Box 96 CEP, Piracicaba, SP 13400-970, Brazil

Cited by 17 (Based on Google Scholar [2017-06-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Koči J, Šimo L, Park Y. Validation of internal reference genes for real-time quantitative polymerase chain reaction studies in the tick, Ixodes scapularis (Acari: Ixodidae)[J]. Journal of medical entomology, 2013, 50(1): 79-84.
↑ Schmutz J, McClean P E, Mamidi S, et al. A reference genome for common bean and genome-wide analysis of dual domestications[J]. Nature genetics, 2014, 46(7): 707-713.