Difference between revisions of "Phytophthora parasitica"

From ICG
Jump to navigation Jump to search
Line 59: Line 59:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer Type===
+
===Molecular Type===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']

Revision as of 14:56, 22 June 2017

Description

Phytophthora parasitica.jpg
  • The oomycete Phytophthora parasitica is a very broad host range pathogen that causes destructive diseases of a wide variety of crop plants, nursery and ornamental plants, and forest ecosystems.
  • The oomycete Phytophthora parasitica is a very broad host range pathogen that causes destructive diseases of a wide variety of crop plants including tomato, pepper, potato, tobacco, cacao, banana, citrus, walnut, almond, a wide variety of nursery and ornamental plants, and forest ecosystems.
  • Phytophthora parasitica is a soilborne pathogen with a wide range of host plants and represents most species in the genus Phytophthora[1][2].

Different Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubc[1] Ubiquitin-conjugating enzyme
  • Asexual stage
  • Sexual reproduction
  • Stage of pathogenesis
CK859493
  • F:CCACTTAGAGCACGCTAGGA
  • R:TACCGACTGTCCTTCGTTCA
152 60 SYBR
WS21[1] 40S ribosomal protein S3A
  • Asexual stage
  • Stage of pathogenesis
CF891675
  • F:CTCCAGAACGTGTACATCCG
  • R:TAGCGCCCTTCTCCTCAG
106 60 SYBR
Tub-b[1] β-tubulin
  • Asexual stage
  • Sexual reproduction
AY564081
  • F:AGGAGATGTTCAAGCGTGTG
  • R:GATCGTTCATGTTGGACTCG
129 60 SYBR

Molecular Type

  • mRNA

Evaluation Methods

Contact

  • Name: Ruey-Fen Liou
  • Email: rXiou@ntu.edu.tw
  • Institution: Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 106, Taiwan

Citation Statistics

Cited by 111 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Yan H Z, Liou R F. Selection of internal control genes for real-time quantitative RT-PCR assays in the oomycete plant pathogen Phytophthora parasitica[J]. Fungal Genetics and Biology, 2006, 43(6): 430-438.
  2. Meng Y, Zhang Q, Ding W, Shan W. Phytophthora parasitica: a model oomycete plant pathogen. Mycology. 2014 Jun;5(2):43-51. Epub 2014 May 19. Review. PubMed PMID: 24999436; PubMed Central PMCID: PMC4066925.