Difference between revisions of "Phytophthora parasitica"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Different Life & Asexual Stage & Sexual Reproduction'''''=== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%...")
 
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
  
=='''''Different Life & Asexual Stage & Sexual Reproduction'''''===
+
=='''''Different Life & Asexual Stage & Sexual Reproduction'''''==
 
===Reference Genes===
 
===Reference Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 62: Line 62:
 
*'''Email''': rXiou@ntu.edu.tw
 
*'''Email''': rXiou@ntu.edu.tw
 
*'''Institution''': Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 106, Taiwan
 
*'''Institution''': Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 106, Taiwan
 +
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>

Revision as of 10:50, 16 June 2017

Description

Different Life & Asexual Stage & Sexual Reproduction

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Ubc[1] ubiquitin-conjugating enzyme
  • asexual stage
  • sexual reproduction
  • stage of pathogenesis
CK859493
  • F:CCACTTAGAGCACGCTAGGA
  • R:TACCGACTGTCCTTCGTTCA
152 60 SYBR
WS21[1] 40S ribosomal protein S3A
  • asexual stage
  • stage of pathogenesis
CF891675
  • F:CTCCAGAACGTGTACATCCG
  • R:TAGCGCCCTTCTCCTCAG
106 60 SYBR
Tub-b[1] β-tubulin
  • asexual stage
  • sexual reproduction
AY564081
  • F:AGGAGATGTTCAAGCGTGTG
  • R:GATCGTTCATGTTGGACTCG
129 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Ruey-Fen Liou
  • Email: rXiou@ntu.edu.tw
  • Institution: Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 106, Taiwan

References

  1. 1.0 1.1 1.2 Yan H Z, Liou R F. Selection of internal control genes for real-time quantitative RT-PCR assays in the oomycete plant pathogen Phytophthora parasitica[J]. Fungal Genetics and Biology, 2006, 43(6): 430-438.