Difference between revisions of "Phytophthora parasitica"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Sebastes schlegeli-1.jpg|right|127px|]]<ref name="ref1"/><ref name="ref2"/>
 
[[File:Sebastes schlegeli-1.jpg|right|127px|]]<ref name="ref1"/><ref name="ref2"/>
 +
*The oomycete Phytophthora parasitica is a very broad host range pathogen that causes destructive diseases of a wide variety of crop plants, nursery and ornamental plants, and forest ecosystems.
  
 
=='''''Different Life & Asexual Stage & Sexual Reproduction'''''==
 
=='''''Different Life & Asexual Stage & Sexual Reproduction'''''==

Revision as of 01:49, 17 June 2017

Description

Sebastes schlegeli-1.jpg

[1][2]

  • The oomycete Phytophthora parasitica is a very broad host range pathogen that causes destructive diseases of a wide variety of crop plants, nursery and ornamental plants, and forest ecosystems.

Different Life & Asexual Stage & Sexual Reproduction

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Ubc[1] ubiquitin-conjugating enzyme
  • asexual stage
  • sexual reproduction
  • stage of pathogenesis
CK859493
  • F:CCACTTAGAGCACGCTAGGA
  • R:TACCGACTGTCCTTCGTTCA
152 60 SYBR
WS21[1] 40S ribosomal protein S3A
  • asexual stage
  • stage of pathogenesis
CF891675
  • F:CTCCAGAACGTGTACATCCG
  • R:TAGCGCCCTTCTCCTCAG
106 60 SYBR
Tub-b[1] β-tubulin
  • asexual stage
  • sexual reproduction
AY564081
  • F:AGGAGATGTTCAAGCGTGTG
  • R:GATCGTTCATGTTGGACTCG
129 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Ruey-Fen Liou
  • Email: rXiou@ntu.edu.tw
  • Institution: Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 106, Taiwan

References

  1. 1.0 1.1 1.2 1.3 Yan H Z, Liou R F. Selection of internal control genes for real-time quantitative RT-PCR assays in the oomycete plant pathogen Phytophthora parasitica[J]. Fungal Genetics and Biology, 2006, 43(6): 430-438.
  2. AAAA