Difference between revisions of "Phytophthora parasitica"

From ICG
Jump to navigation Jump to search
 
(33 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Sebastes schlegeli-1.jpg|right|127px|]]<ref name="ref1"/><ref name="ref1"/>
 
  
=='''''Different Life & Asexual Stage & Sexual Reproduction'''''==
+
[[File:Phytophthora parasitica.png|right|200px|link=Phytophthora parasitica]]
===Reference Genes===
+
* '''''Phytophthora parasitica''''', a kind of oomycete that represents most species in the genus ''Phytophthora''. It is a soilborne pathogen that causes destructive diseases of a wide variety of crop plants including tomato, pepper, potato, tobacco, cacao, banana, citrus, walnut, almond, a wide variety of nursery and ornamental plants, and forest ecosystems<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''NA'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4792 <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
 +
=='''''Different Developmental Stages'''''==
 +
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 10: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 16: Line 20:
 
|-
 
|-
 
|align="center"| Ubc<ref name="ref1"/>
 
|align="center"| Ubc<ref name="ref1"/>
|align="center"| ubiquitin-conjugating enzyme
+
|align="center"| Ubiquitin-conjugating enzyme
 
|
 
|
*asexual stage
+
*Asexual stage
*sexual reproduction
+
*Sexual reproduction
*stage of pathogenesis
+
*Stage of pathogenesis
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CK859493 '''CK859493''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CK859493 '''CK859493''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 32: Line 36:
 
|align="center"| 40S ribosomal protein S3A
 
|align="center"| 40S ribosomal protein S3A
 
|
 
|
*asexual stage
+
*Asexual stage
*stage of pathogenesis
+
*Stage of pathogenesis
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CF891675 '''CF891675''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CF891675 '''CF891675''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 49:
 
|align="center"| β-tubulin
 
|align="center"| β-tubulin
 
|
 
|
*asexual stage
+
*Asexual stage
*sexual reproduction
+
*Sexual reproduction
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY564081 '''AY564081''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY564081 '''AY564081''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 55: Line 59:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer Type===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
===Contact===
 
===Contact===
 
*'''Name''': Ruey-Fen Liou
 
*'''Name''': Ruey-Fen Liou
*'''Email''': rXiou@ntu.edu.tw
+
*'''Email''': rfliou@ntu.edu.tw
 
*'''Institution''': Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 106, Taiwan
 
*'''Institution''': Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 106, Taiwan
 +
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=16247283564905942417&as_sdt=2005&sciodt=0,5&hl=en '''110'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 70: Line 79:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
AAAA
+
Meng Y, Zhang Q, Ding W, Shan W. Phytophthora parasitica: a model oomycete
 +
plant pathogen. Mycology. 2014 Jun;5(2):43-51. Epub 2014 May 19. Review. PubMed
 +
PMID: 24999436; PubMed Central PMCID: PMC4066925.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 +
[[Category:Bacteria]]
 +
[[Category:mRNA]]
 +
[[Category:SYBR]]
 +
[[Category:RPS]] [[Category:Tubulin]] [[Category:Ubiquitin]]
 +
[[Category:Different Developmental Stages]]
 +
 +
[[Category:geNorm]]

Latest revision as of 05:01, 1 September 2017

Description

Phytophthora parasitica.png
  • Phytophthora parasitica, a kind of oomycete that represents most species in the genus Phytophthora. It is a soilborne pathogen that causes destructive diseases of a wide variety of crop plants including tomato, pepper, potato, tobacco, cacao, banana, citrus, walnut, almond, a wide variety of nursery and ornamental plants, and forest ecosystems[1][2].
  • Common Name: NA
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubc[1] Ubiquitin-conjugating enzyme
  • Asexual stage
  • Sexual reproduction
  • Stage of pathogenesis
CK859493
  • F:CCACTTAGAGCACGCTAGGA
  • R:TACCGACTGTCCTTCGTTCA
152 60 SYBR
WS21[1] 40S ribosomal protein S3A
  • Asexual stage
  • Stage of pathogenesis
CF891675
  • F:CTCCAGAACGTGTACATCCG
  • R:TAGCGCCCTTCTCCTCAG
106 60 SYBR
Tub-b[1] β-tubulin
  • Asexual stage
  • Sexual reproduction
AY564081
  • F:AGGAGATGTTCAAGCGTGTG
  • R:GATCGTTCATGTTGGACTCG
129 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ruey-Fen Liou
  • Email: rfliou@ntu.edu.tw
  • Institution: Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 106, Taiwan

Citation Statistics

Cited by 110 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Yan H Z, Liou R F. Selection of internal control genes for real-time quantitative RT-PCR assays in the oomycete plant pathogen Phytophthora parasitica[J]. Fungal Genetics and Biology, 2006, 43(6): 430-438.
  2. Meng Y, Zhang Q, Ding W, Shan W. Phytophthora parasitica: a model oomycete plant pathogen. Mycology. 2014 Jun;5(2):43-51. Epub 2014 May 19. Review. PubMed PMID: 24999436; PubMed Central PMCID: PMC4066925.

Categories