Difference between revisions of "Pinus massoniana"

Revision as of 08:46, 11 August 2017

Pinus massoniana belongs to the family Pinaceae Lindl., Pinus Linn. This adaptable and rapidly growing species is a typical ancient coniferous unique native tree in the southern part of China and is widely distributed throughout the 17 provinces (autonomous regions) of China. PM is distributed over a 2 million km2 area and is a particularly important type of local conifer. This tree can be fast-growing with a high yield and is comprehensively utilized; e.g., PM is used in the development of PM man-made forests in the Chinese forest industry ^[1]^[2].
Common Name: Chinese red pine
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Fbox^[2]	F-box family protein	Salt stress Drought stress	KM496542	F:GCAGAGGTGGAGAGTGGAAG R:GGTGGTTTATGTTGCCGAAT	111	60	SYBR
UBI11^[2]	Polyubiquitin 11	Salt stress	KM496540	F:AATCAACCCTGCATCTCGTC R:CTGGATCTTGGCCTTGACAT	131	60	SYBR
RRP8^[2]	ribosomal RNA-processing protein 8	Drought stress	KM496537	F:GCAGGTTATCAGGAGCAGATG R:GATGGTTCACAGGAGACGAGA	179	60	SYBR
ARF^[2]	ADP-ribosylation factor	Low temperature stress	KM496546	F:GAACAAACCTTCTTTGCATGG R:GGACTCAAGACCCATCTGGT	109	58~59	SYBR
TUBA^[2]	Tubulin alpha	Low temperature stress	KM496535	F:CCAGTTTGTTGATTGGTGTCC R:ACGGCTCTCTGAACCTTGG	102	60	SYBR
EF1B^[2]	Elongation factor 1-beta	Flowers in different developmental phases	KM496533	F:GGTGAAGAAACCGAAGAGGAA R:CCACAGCAAACCATCCATC	186	60	SYBR
IDH^[2]	Isocitrate dehydrogenase	Flowers in different developmental phases	KM496545	F:CAGTAAGACCCACGCAGTTC R:CGTCATTTCATCACCATCCA	100	58~60	SYBR

Name: Zhangqi Yang
Email: yangzhangqi@163.com
Institute: Guangxi Key Laboratory of Superior Timber Trees Resource Cultivation, Guangxi Forestry Research Institute of Science, Nanning 530002, People’s Republic of China

Cited by 4 (Based on Google Scholar [2017-08-10])

↑ Hu Chen, Zhangqi Yang, Ying Hu, Jianhui Tan, Jie Jia, Hulan Xu, Xinhua Chen. Reference genes selection for quantitative gene expression studies in Pinus massoniana L. Trees DOI 10.1007/s00468-015-1311-3
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 Chen, Hu, et al. "Reference genes selection for quantitative gene expression studies in Pinus massoniana L." Trees 30.3 (2016): 685-696.

@@ Line 114: / Line 114: @@
 *'''Institute''': Guangxi Key Laboratory of Superior Timber Trees Resource Cultivation, Guangxi Forestry Research Institute of Science, Nanning 530002, People’s Republic of China
 ===Citation Statistics===
-Cited by '''??''' (Based on Google Scholar [2017-08-01])
+Cited by '''4''' (Based on Google Scholar [2017-08-10])
 =='''References'''==