Difference between revisions of "Platycladus orientalis"

From ICG
Jump to navigation Jump to search
 
(16 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:REFqPCRPlatycladus_orientalis.jpg|right|227px|]]
+
[[File:Platycladus orientalis.png|right|200px|link=Platycladus orientalis]]
*'''''Platycladus orientalis''''' is a tree species that is highly resistant, widely adaptable, and long-lived, with lifespans of even thousands of years. As a member of the Cupressaceae, it is used extensively as a medicinal ingredient and as an ornamental landscape plant that can tolerate a wide range of environmental extremes. Many individuals of this species have lifespans of one to several thousands of years in China.
+
*'''''Platycladus orientalis''''' is a tree species that is highly resistant, widely adaptable, and long-lived, with lifespans of even thousands of years. As a member of the Cupressaceae, it is used extensively as a medicinal ingredient and as an ornamental landscape plant that can tolerate a wide range of environmental extremes. Many individuals of this species have lifespans of one to several thousands of years in China<ref name="ref1"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Cupressaceae'''
 
* <font color=blue>'''Common Name:'''</font> '''Cupressaceae'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=58046 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=58046 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''Different Tissues &  Abiotic Stress'''==
 
=='''Different Tissues &  Abiotic Stress'''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 18: Line 18:
 
! Detection
 
! Detection
 
|-
 
|-
|align="center"| ACT7<ref name="ref1"/><ref name="ref2"/>
+
|align="center"| ACT7<ref name="ref1"/>
 
|align="center"| Actin 7  
 
|align="center"| Actin 7  
 
|
 
|
Line 59: Line 59:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''91''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=117938035228704675&as_sdt=2005&sciodt=0,5&hl=en'''98'''] (Based on Google Scholar [2017-09-01])
 
 
=='''Different Tissues & Treatments'''==
 
===Reference Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
! Gene Symbol 
 
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope
 
! Accession Number
 
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]
 
! Tm [℃]
 
! Detection
 
|-
 
|align="center"| aTUB<ref name="ref2"/>
 
|align="center"| Alpha-tubulin
 
|
 
* Response to stress/senescence
 
|align="center"|  NA
 
|nowrap style="font-size:9pt"|
 
* F:CCACATCTCTTAGGTTTGATGGAG
 
* R:GGGTCACACTTGGCCATCAT
 
|align="center"| 205
 
|align="center"| 60
 
|align="center"| SYBR
 
|-
 
|align="center"| UBC <ref name="ref2"/>
 
|align="center"| Ubiquitin-conjugating enzyme E2
 
|
 
* Response to stress/senescence
 
|align="center"|  NA
 
|nowrap style="font-size:9pt"|
 
* F:TCTTGCTGAAGAGCGGAAGG
 
* R:ATGCACTGCCAGACCATCAA
 
|align="center"| 108
 
|align="center"| 60
 
|align="center"| SYBR
 
|}
 
 
 
===Molecular Types===
 
* mRNA
 
 
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 
===Contact===
 
*'''Name''': Ermei Chang
 
*'''Email''': jiangzp@caf.ac.cn
 
*'''Institute''':  State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China
 
  
 
=='''References'''==
 
=='''References'''==
Line 115: Line 65:
 
<ref name="ref1">
 
<ref name="ref1">
 
Chang E, Shi S, Liu J, et al. Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (Cupressaceae) using real-time PCR[J]. PloS one, 2012, 7(3): e33278.
 
Chang E, Shi S, Liu J, et al. Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (Cupressaceae) using real-time PCR[J]. PloS one, 2012, 7(3): e33278.
</ref>
 
<ref name="ref2">
 
Ermei Chang, Shengqing Shi, Jianfeng Liu, Tielong Cheng, Liang Xue, Xiuyan Yang, Wenjuan Yang, Qian Lan, and Zeping Jiang. Selection of Reference Genes for Quantitative Gene Expression Studies in Platycladus orientalis (Cupressaceae) Using Real-Time PCR. BPLoS One. 2012; 7(3): e33278.
 
 
</ref>
 
</ref>
 
</references>
 
</references>
  
[[Category:Plants]]
+
=='''Categories'''==
[[Category:mRNA]] 
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]][[Category:Ubiquitin]][[Category:Ubiquitin]][[Category:Hormone Treatment]][[Category:Different Tissues]]  [[Category:Abiotic Stress]][[Category:Cold Treatment]][[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]]
[[Category:SYBR]]
 
[[Category:ACT]] [[Category:Tubulin]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]
 
[[Category:Hormone Treatment]] [[Category:Different Tissues]]  [[Category:Abiotic Stress]] [[Category:Cold Treatment]]
 

Latest revision as of 07:21, 1 September 2017

Description

Platycladus orientalis.png
  • Platycladus orientalis is a tree species that is highly resistant, widely adaptable, and long-lived, with lifespans of even thousands of years. As a member of the Cupressaceae, it is used extensively as a medicinal ingredient and as an ornamental landscape plant that can tolerate a wide range of environmental extremes. Many individuals of this species have lifespans of one to several thousands of years in China[1].
  • Common Name: Cupressaceae
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT7[1] Actin 7
  • Different tissues
  • Cold treated
NA
  • F:GGAGGTTCCACCATGTTTCC
  • R:GTGCTGAGCGAAGCGAGAAT
152 60 SYBR
UBQ [1] Ubiquitin 10
  • NaCl-treated
  • ABA-treated
NA
  • F:AGGGGAGGCATGCAGATTTT
  • R:AGGAATGCCCTCCTTGTCCT
120 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zeping Jiang
  • Email: jiangzp@caf.ac.cn
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 98 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Chang E, Shi S, Liu J, et al. Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (Cupressaceae) using real-time PCR[J]. PloS one, 2012, 7(3): e33278.

Categories