Difference between revisions of "Platycladus orientalis"

From ICG
Jump to navigation Jump to search
Line 109: Line 109:
 
*'''Name''': Ermei Chang
 
*'''Name''': Ermei Chang
 
*'''Email''': jiangzp@caf.ac.cn
 
*'''Email''': jiangzp@caf.ac.cn
*'''Institute''':  State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China
+
*'''Institution''':  State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China
  
 
=='''References'''==
 
=='''References'''==

Revision as of 14:52, 23 June 2017

Description

REFqPCRPlatycladus orientalis.jpg
  • Platycladus orientalis is a tree species that is highly resistant, widely adaptable, and long-lived, with lifespans of even thousands of years. As a member of the Cupressaceae, it is used extensively as a medicinal ingredient and as an ornamental landscape plant that can tolerate a wide range of environmental extremes. Many individuals of this species have lifespans of one to several thousands of years in China.
  • Common Name: Cupressaceae
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT7[1][2] Actin 7
  • Different tissues
  • Cold treated
NA
  • F:GGAGGTTCCACCATGTTTCC
  • R:GTGCTGAGCGAAGCGAGAAT
152 60 SYBR
UBQ [1] Ubiquitin 10
  • NaCl-treated
  • ABA-treated
NA
  • F:AGGGGAGGCATGCAGATTTT
  • R:AGGAATGCCCTCCTTGTCCT
120 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zeping Jiang
  • Email: jiangzp@caf.ac.cn
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 91 (Based on Google Scholar [2017-06-16])

Different Tissues & Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
aTUB[2] Alpha-tubulin
  • Response to stress/senescence
NA
  • F:CCACATCTCTTAGGTTTGATGGAG
  • R:GGGTCACACTTGGCCATCAT
205 60 SYBR
UBC [2] Ubiquitin-conjugating enzyme E2
  • Response to stress/senescence
NA
  • F:TCTTGCTGAAGAGCGGAAGG
  • R:ATGCACTGCCAGACCATCAA
108 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ermei Chang
  • Email: jiangzp@caf.ac.cn
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China

References

  1. 1.0 1.1 Chang E, Shi S, Liu J, et al. Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (Cupressaceae) using real-time PCR[J]. PloS one, 2012, 7(3): e33278.
  2. 2.0 2.1 2.2 Ermei Chang, Shengqing Shi, Jianfeng Liu, Tielong Cheng, Liang Xue, Xiuyan Yang, Wenjuan Yang, Qian Lan, and Zeping Jiang. Selection of Reference Genes for Quantitative Gene Expression Studies in Platycladus orientalis (Cupressaceae) Using Real-Time PCR. BPLoS One. 2012; 7(3): e33278.