Difference between revisions of "Platycladus orientalis"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''Different Ages & Tissues & Treatments'''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene symbol...")
 
Line 59: Line 59:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
[[Category:Plants]]

Revision as of 10:24, 16 June 2017

Description

Different Ages & Tissues & Treatments

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT7[1] Actin 7
  • different tissues
  • cold treated
AT5G09810
  • F:GGAGGTTCCACCATGTTTCC
  • R:GTGCTGAGCGAAGCGAGAAT
152 60 SYBR
UBQ [1] Ubiquitin 10
  • NaCl-treated
  • ABA-treated
AT5G20620
  • F:AGGGGAGGCATGCAGATTTT
  • R:AGGAATGCCCTCCTTGTCCT
120 58 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Zeping Jiang
  • Email: jiangzp@caf.ac.cn
  • Institute: State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China

References

  1. 1.0 1.1 Chang E, Shi S, Liu J, et al. Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (Cupressaceae) using real-time PCR[J]. PloS one, 2012, 7(3): e33278.