Difference between revisions of "Platycladus orientalis"

From ICG
Jump to navigation Jump to search
Line 4: Line 4:
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
! Gene symbol  
+
! Gene Symbol  
! Gene name
+
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
Line 40: Line 40:
 
|}
 
|}
  
===Moleculer types===
+
===Moleculer Types===
 
* mRNA
 
* mRNA
  
Line 52: Line 52:
 
*'''Email''': jiangzp@caf.ac.cn
 
*'''Email''': jiangzp@caf.ac.cn
 
*'''Institute''':  State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China
 
*'''Institute''':  State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China
 +
===Citation Statistics===
 +
Cited by '''91''' (Based on Google Scholar [2017-06-16])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 10:25, 16 June 2017

Description

Different Ages & Tissues & Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT7[1] Actin 7
  • different tissues
  • cold treated
AT5G09810
  • F:GGAGGTTCCACCATGTTTCC
  • R:GTGCTGAGCGAAGCGAGAAT
152 60 SYBR
UBQ [1] Ubiquitin 10
  • NaCl-treated
  • ABA-treated
AT5G20620
  • F:AGGGGAGGCATGCAGATTTT
  • R:AGGAATGCCCTCCTTGTCCT
120 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zeping Jiang
  • Email: jiangzp@caf.ac.cn
  • Institute: State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 91 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Chang E, Shi S, Liu J, et al. Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (Cupressaceae) using real-time PCR[J]. PloS one, 2012, 7(3): e33278.