Platycladus orientalis

From ICG
Jump to navigation Jump to search

Description

Different Ages & Tissues & Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT7[1] Actin 7
  • different tissues
  • cold treated
AT5G09810
  • F:GGAGGTTCCACCATGTTTCC
  • R:GTGCTGAGCGAAGCGAGAAT
152 60 SYBR
UBQ [1] Ubiquitin 10
  • NaCl-treated
  • ABA-treated
AT5G20620
  • F:AGGGGAGGCATGCAGATTTT
  • R:AGGAATGCCCTCCTTGTCCT
120 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zeping Jiang
  • Email: jiangzp@caf.ac.cn
  • Institute: State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry, Beijing, People’s Republic of China

Citation Statistics

Cited by 91 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Chang E, Shi S, Liu J, et al. Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (Cupressaceae) using real-time PCR[J]. PloS one, 2012, 7(3): e33278.