Difference between revisions of "Pleurotus ostreatus"
Jump to navigation
Jump to search
Cao Jiabao (talk | contribs) |
|||
| Line 4: | Line 4: | ||
* <font color=blue>'''Common Name:'''</font> '''oyster mushroom''' | * <font color=blue>'''Common Name:'''</font> '''oyster mushroom''' | ||
*[https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5322&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>] | *[https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5322&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>] | ||
| − | + | ===Reference Genes=== | |
| + | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
| + | |- | ||
| + | ! Gene Symbol | ||
| + | ! Gene Name | ||
| + | ! style="width=25% font-size:9pt "|Application Scope | ||
| + | ! Accession Number | ||
| + | ! Primers (5'-3')<br>[Forward/Reverse] | ||
| + | ! Size [bp] | ||
| + | ! Tm [℃] | ||
| + | ! Detection | ||
| + | |- | ||
| + | |align="center"| sar1<ref name="ref1"/> | ||
| + | |align="center"| Secretion-associated Ras-related 1 | ||
| + | | | ||
| + | *SmF cultures | ||
| + | |align="center"| NA | ||
| + | |nowrap style="font-size:9pt"| | ||
| + | * F:GGATAGTCTTCCTCGTCGATAG | ||
| + | * R:GGGTGCGTCAATCTTGTTAC | ||
| + | |align="center"| 133 | ||
| + | |align="center"| 63 | ||
| + | |align="center"| SYBR | ||
| + | |- | ||
| + | |align="center"| pep<ref name="ref1"/> | ||
| + | |align="center"| strain EPGS | ||
| + | | | ||
| + | *SmF cultures | ||
| + | |align="center"| NA | ||
| + | |nowrap style="font-size:9pt"| | ||
| + | * F:TGATTCCAGAGGACAAGGACGCAA | ||
| + | * R:AAATCTTCCGCGATACGGGTCACT | ||
| + | |align="center"| 148 | ||
| + | |align="center"| 63 | ||
| + | |align="center"| SYBR | ||
| + | |- | ||
| + | |align="center"| phos<ref name="ref1"/> | ||
| + | |align="center"| phosphate-binding protein PhoS | ||
| + | | | ||
| + | *SmF cultures | ||
| + | |align="center"| NA | ||
| + | |nowrap style="font-size:9pt"| | ||
| + | * F:CATCGCAAATCATCGATCGCACCA | ||
| + | * R:GCTCTCCAGCCAATGCACCAATTT | ||
| + | |align="center"| 125 | ||
| + | |align="center"| 63 | ||
| + | |align="center"| SYBR | ||
| + | |} | ||
| + | ===Moleculer types=== | ||
| + | * mRNA | ||
| + | ===Evaluation Methods=== | ||
| + | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
| + | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
| + | * [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference'''] | ||
| + | ===Contact=== | ||
| + | *'''Name''': Lucía Ramírez | ||
| + | *'''Email''': lramirez@unavarra.es | ||
| + | *'''Institute''': Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, Pamplona, Navarre, Spain | ||
| + | ===Citation Statistics=== | ||
| + | Cited by '''??''' (Based on Google Scholar [2017-08-01]) | ||
=='''References'''== | =='''References'''== | ||
<references> | <references> | ||
Revision as of 16:28, 22 July 2017
Contents
Description
- Pleurotus ostreatus is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value.[1]
- Common Name: oyster mushroom
- NCBI Taxonomy
Reference Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| sar1[1] | Secretion-associated Ras-related 1 |
|
NA |
|
133 | 63 | SYBR |
| pep[1] | strain EPGS |
|
NA |
|
148 | 63 | SYBR |
| phos[1] | phosphate-binding protein PhoS |
|
NA |
|
125 | 63 | SYBR |
Moleculer types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Lucía Ramírez
- Email: lramirez@unavarra.es
- Institute: Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, Pamplona, Navarre, Spain
Citation Statistics
Cited by ?? (Based on Google Scholar [2017-08-01])
References
- ↑ 1.0 1.1 1.2 1.3 Castanera R, López-Varas L, Pisabarro AG, Ramírez L. Validation of Reference Genes for Transcriptional Analyses in Pleurotus ostreatus by Using Reverse Transcription-Quantitative PCR. Appl Environ Microbiol. 2015 Jun 15;81(12):4120-9. doi: 10.1128/AEM.00402-15. Epub 2015 Apr 10. PubMed PMID: 25862220; PubMed Central PMCID: PMC4524153.
