Difference between revisions of "Pleurotus ostreatus"

From ICG
Jump to navigation Jump to search
Line 4: Line 4:
 
* <font color=blue>'''Common Name:'''</font> '''oyster mushroom'''
 
* <font color=blue>'''Common Name:'''</font> '''oyster mushroom'''
 
*[https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5322&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>]
 
*[https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5322&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>]
 +
=='''''Various Culture Conditions'''''==
 
===Reference Genes===
 
===Reference Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 64: Line 65:
 
===Citation Statistics===
 
===Citation Statistics===
 
Cited by '''??''' (Based on Google Scholar [2017-08-01])
 
Cited by '''??''' (Based on Google Scholar [2017-08-01])
 +
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>

Revision as of 16:29, 22 July 2017

Description

Pleurotus ostreatus-1.jpg
  • Pleurotus ostreatus is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value.[1]
  • Common Name: oyster mushroom
  • NCBI Taxonomy

Various Culture Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
sar1[1] Secretion-associated Ras-related 1
  • SmF cultures
NA
  • F:GGATAGTCTTCCTCGTCGATAG
  • R:GGGTGCGTCAATCTTGTTAC
133 63 SYBR
pep[1]  strain EPGS 
  • SmF cultures
NA
  • F:TGATTCCAGAGGACAAGGACGCAA
  • R:AAATCTTCCGCGATACGGGTCACT
148 63 SYBR
phos[1] phosphate-binding protein PhoS
  • SmF cultures
NA
  • F:CATCGCAAATCATCGATCGCACCA
  • R:GCTCTCCAGCCAATGCACCAATTT
125 63 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Lucía Ramírez
  • Email: lramirez@unavarra.es
  • Institute: Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, Pamplona, Navarre, Spain

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. 1.0 1.1 1.2 1.3 Castanera R, López-Varas L, Pisabarro AG, Ramírez L. Validation of Reference Genes for Transcriptional Analyses in Pleurotus ostreatus by Using Reverse Transcription-Quantitative PCR. Appl Environ Microbiol. 2015 Jun 15;81(12):4120-9. doi: 10.1128/AEM.00402-15. Epub 2015 Apr 10. PubMed PMID: 25862220; PubMed Central PMCID: PMC4524153.