Difference between revisions of "Pleurotus ostreatus"

Revision as of 05:58, 10 August 2017

Pleurotus ostreatus is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value ^[1].
Common Name: Oyster mushroom
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
sar1^[1]	Secretion-associated Ras-related 1	SmF cultures	NA	F:GGATAGTCTTCCTCGTCGATAG R:GGGTGCGTCAATCTTGTTAC	133	63	SYBR
pep^[1]	strain EPGS	SmF cultures	NA	F:TGATTCCAGAGGACAAGGACGCAA R:AAATCTTCCGCGATACGGGTCACT	148	63	SYBR
phos^[1]	phosphate-binding protein PhoS	SmF cultures	NA	F:CATCGCAAATCATCGATCGCACCA R:GCTCTCCAGCCAATGCACCAATTT	125	63	SYBR

Name: Lucía Ramírez
Email: lramirez@unavarra.es
Institute: Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, Pamplona, Navarre, Spain

Cited by ?? (Based on Google Scholar [2017-08-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Castanera R, López-Varas L, Pisabarro AG, Ramírez L. Validation of Reference Genes for Transcriptional Analyses in Pleurotus ostreatus by Using Reverse Transcription-Quantitative PCR. Appl Environ Microbiol. 2015 Jun 15;81(12):4120-9. doi: 10.1128/AEM.00402-15. Epub 2015 Apr 10. PubMed PMID: 25862220; PubMed Central PMCID: PMC4524153.

@@ Line 1: / Line 1: @@
 =='''Description'''==
 [[File:Pleurotus ostreatus-1.jpg|right|200px|link=Pleurotus ostreatus]]
-*'''''Pleurotus ostreatus''''' is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value.<ref name="ref1"/>
+*'''''Pleurotus ostreatus''''' is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value <ref name="ref1"/>.
 * <font color=blue>'''Common Name:'''</font> '''Oyster mushroom'''
 *[https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5322&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>]