Difference between revisions of "Pleurotus ostreatus"
Jump to navigation
Jump to search
Cao Jiabao (talk | contribs) |
Cao Jiabao (talk | contribs) |
||
(15 intermediate revisions by 5 users not shown) | |||
Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
− | [[File:Pleurotus ostreatus-1.jpg|right| | + | [[File:Pleurotus ostreatus-1.jpg|right|200px|link=Pleurotus ostreatus]] |
− | *'''''Pleurotus ostreatus''''' is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value | + | *'''''Pleurotus ostreatus''''' is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value <ref name="ref1"/>. |
− | * <font color=blue>'''Common Name:'''</font> ''' | + | * <font color=blue>'''Common Name:'''</font> '''Oyster mushroom''' |
*[https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5322&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>] | *[https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5322&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>] | ||
+ | |||
+ | =='''''Various Culture Conditions'''''== | ||
+ | ===Internal Control Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primers (5'-3')<br>[Forward/Reverse] | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| sar1<ref name="ref1"/> | ||
+ | |align="center"| Secretion-associated Ras-related 1 | ||
+ | | | ||
+ | *SmF cultures | ||
+ | |align="center"| NA | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GGATAGTCTTCCTCGTCGATAG | ||
+ | * R:GGGTGCGTCAATCTTGTTAC | ||
+ | |align="center"| 133 | ||
+ | |align="center"| 63 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| pep<ref name="ref1"/> | ||
+ | |align="center"| strain EPGS | ||
+ | | | ||
+ | *SmF cultures | ||
+ | |align="center"| NA | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TGATTCCAGAGGACAAGGACGCAA | ||
+ | * R:AAATCTTCCGCGATACGGGTCACT | ||
+ | |align="center"| 148 | ||
+ | |align="center"| 63 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| phos<ref name="ref1"/> | ||
+ | |align="center"| phosphate-binding protein PhoS | ||
+ | | | ||
+ | *SmF cultures | ||
+ | |align="center"| NA | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CATCGCAAATCATCGATCGCACCA | ||
+ | * R:GCTCTCCAGCCAATGCACCAATTT | ||
+ | |align="center"| 125 | ||
+ | |align="center"| 63 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | |||
+ | ===Molecular Types=== | ||
+ | * mRNA | ||
+ | |||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | * [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Lucía Ramírez | ||
+ | *'''Email''': lramirez@unavarra.es | ||
+ | *'''Institution''': Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, Pamplona, Navarre, Spain | ||
+ | |||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=2826155834730814237&as_sdt=2005&sciodt=0,5&hl=en '''7'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 15: | Line 80: | ||
</ref> | </ref> | ||
</references> | </references> | ||
+ | |||
+ | =='''Categories'''== | ||
+ | [[Category:Various Culture Conditions]] | ||
+ | [[Category:sar1]] [[Category:pep]] [[Category:phos]] | ||
+ | [[Category:Fungi]] | ||
+ | [[Category:SYBR]] | ||
+ | [[Category:geNorm]] | ||
+ | [[Category:NormFinder]] | ||
+ | [[Category:BestKeeper]] |
Latest revision as of 05:22, 1 September 2017
Contents
Description
- Pleurotus ostreatus is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value [1].
- Common Name: Oyster mushroom
- NCBI Taxonomy
Various Culture Conditions
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
sar1[1] | Secretion-associated Ras-related 1 |
|
NA |
|
133 | 63 | SYBR |
pep[1] | strain EPGS |
|
NA |
|
148 | 63 | SYBR |
phos[1] | phosphate-binding protein PhoS |
|
NA |
|
125 | 63 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Lucía Ramírez
- Email: lramirez@unavarra.es
- Institution: Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, Pamplona, Navarre, Spain
Citation Statistics
Cited by 7 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 Castanera R, López-Varas L, Pisabarro AG, Ramírez L. Validation of Reference Genes for Transcriptional Analyses in Pleurotus ostreatus by Using Reverse Transcription-Quantitative PCR. Appl Environ Microbiol. 2015 Jun 15;81(12):4120-9. doi: 10.1128/AEM.00402-15. Epub 2015 Apr 10. PubMed PMID: 25862220; PubMed Central PMCID: PMC4524153.