Difference between revisions of "Pleurotus ostreatus"

From ICG
Jump to navigation Jump to search
 
(13 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Pleurotus ostreatus-1.jpg|right|270px]]
+
[[File:Pleurotus ostreatus-1.jpg|right|200px|link=Pleurotus ostreatus]]
*'''''Pleurotus ostreatus''''' is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value.<ref name="ref1"/>
+
*'''''Pleurotus ostreatus''''' is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value <ref name="ref1"/>.
* <font color=blue>'''Common Name:'''</font> '''oyster mushroom'''
+
* <font color=blue>'''Common Name:'''</font> '''Oyster mushroom'''
 
*[https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5322&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>]
 
*[https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5322&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
=='''''Various Culture Conditions'''''==
 
=='''''Various Culture Conditions'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 53: Line 54:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer types===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 62: Line 65:
 
*'''Name''': Lucía Ramírez
 
*'''Name''': Lucía Ramírez
 
*'''Email''': lramirez@unavarra.es
 
*'''Email''': lramirez@unavarra.es
*'''Institute''': Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, Pamplona, Navarre, Spain
+
*'''Institution''': Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, Pamplona, Navarre, Spain
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''??''' (Based on Google Scholar [2017-08-01])
+
Cited by [https://scholar.google.com/scholar?cites=2826155834730814237&as_sdt=2005&sciodt=0,5&hl=en '''7'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 76: Line 80:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 +
[[Category:Various Culture Conditions]]
 +
[[Category:sar1]] [[Category:pep]] [[Category:phos]]
 +
[[Category:Fungi]]
 +
[[Category:SYBR]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 05:22, 1 September 2017

Description

Pleurotus ostreatus-1.jpg
  • Pleurotus ostreatus is an efficient producer of extracellular enzymes, such as laccases (Lacs; EC 1.10.3.2) and he basidiomycete Pleurotus ostreatus is an efficient producer of manganese peroxidases (MnPs; EC 1.11.1.13), which are notable for their application in multiple industrial and biotechnological processes. It has a special relevance in agroindustry due to its worldwide cultivation for mushroom production, and it has also been studied for its nutritional and medicinal value [1].
  • Common Name: Oyster mushroom
  • NCBI Taxonomy

Various Culture Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
sar1[1] Secretion-associated Ras-related 1
  • SmF cultures
NA
  • F:GGATAGTCTTCCTCGTCGATAG
  • R:GGGTGCGTCAATCTTGTTAC
133 63 SYBR
pep[1]  strain EPGS 
  • SmF cultures
NA
  • F:TGATTCCAGAGGACAAGGACGCAA
  • R:AAATCTTCCGCGATACGGGTCACT
148 63 SYBR
phos[1] phosphate-binding protein PhoS
  • SmF cultures
NA
  • F:CATCGCAAATCATCGATCGCACCA
  • R:GCTCTCCAGCCAATGCACCAATTT
125 63 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Lucía Ramírez
  • Email: lramirez@unavarra.es
  • Institution: Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, Pamplona, Navarre, Spain

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Castanera R, López-Varas L, Pisabarro AG, Ramírez L. Validation of Reference Genes for Transcriptional Analyses in Pleurotus ostreatus by Using Reverse Transcription-Quantitative PCR. Appl Environ Microbiol. 2015 Jun 15;81(12):4120-9. doi: 10.1128/AEM.00402-15. Epub 2015 Apr 10. PubMed PMID: 25862220; PubMed Central PMCID: PMC4524153.

Categories