Plutella xylostella

From ICG
Jump to navigation Jump to search

Description

Plutella xylostella.png
  • The diamondback moth, Plutella xylostella (L.) (Lepidoptera: Plutellidae), is a highly destructive pest of cruciferous crops worldwide, and has developed resistance to a wide array of insecticides. P. xylostella genome is the very first genome documenting an insect pest of agricultural importance. Plus, P. xylostella has become an emerging insect model to study insect-plant interactions[1] [2] [3].
  • Common Name: Diamondback moth
  • NCBI Taxonomy

Different Developmental Stages & Tissues & Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS13[1] Ribosomal protein S13
  • Development stage, Photoperiod, Insecticide susceptibility
AY174891
  • F:TCAGGCTTATTCTCGTCG
  • R:GCTGTGCTGGATTCGTAC
100 60 SYBR
RPS23[1] Ribosomal protein S23
  • Development stage, Tissue, Insecticide susceptibility
AY174891
  • F:ATGGGCTGACAAGGATTAC
  • R:TGCGGATGGCAGAGTT
140 60 SYBR
EF1[1] Elongation factor 1
  • Development stage, Tissue, Strain, Insecticide susceptibility,Photoperiod,Mechanical injury
EF417849
  • F:GCCTCCCTACAGCGAATC
  • R:CCTTGAACCAGGGCATCT
161 60 SYBR
RPL32[1] Ribosomal protein L32
  • Tissue,Temperature, Strain, Insecticide susceptibility,Photoperiod,Mechanical injury
AB180441
  • F:CCAATTTACCGCCCTACC
  • R:TACCCTGTTGTCAATACCTCT
120 60 SYBR
ACTB[1] β-actin
  • Strain & Temperature
AB282645
  • F:GCGACTTGACCGACTACCT
  • R:GCCGCAAGATTCCATACCC
272 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehy- drogenase
  • Strain
AJ489521
  • F:GCCACCACTGCCACTC
  • R:CGGGACGGGAACACG
177 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Youjun Zhang
  • Email: zhangyoujun@caas.cn
  • Institution: Institute of Pesticide Science, Hunan Agricultural University, Changsha 410128, China

Citation Statistics

Cited by 52 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Fu W, Xie W, Zhang Z, et al. Exploring valid reference genes for quantitative real-time PCR analysis in Plutella xylostella (Lepidoptera: Plutellidae)[J]. International journal of biological sciences, 2013, 9(8): 792.
  2. Talekar N, Shelton A. Biology, ecology, and management of the diamondback moth. Annu Rev Entomol. 1993; 38: 275-301.
  3. You M, Yue Z, He W, et al. A heterozygous moth genome provides insights into herbivory and detoxification. Nat Genetics. 2013; 45: 220–225.