Difference between revisions of "Poa pratensis"

Revision as of 08:42, 11 August 2017

Kentucky bluegrass (Poa pratensis L.) belongs to the Gramineae family and is widely used in lawns, golf courses, landscapes, and sports fields as a prominent cool-season grass ^[1].This grass is often subjected to various abiotic stresses, which result in reduced aesthetic quality and seed yield ^[2].
Common Name: Kentucky bluegrass
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
SAM^[1]	S-Adenosylmethionine decarboxylase	Leaves under salt stress and cold stress Drought-treated leaves Heat-treated leaves	NA	F:GCTTCTCTGAGGAGGTTGATGTC R:GCTCGGTGGCATAGTAGATGTG	126	55	SYBR
GAPDH^[1]	Glyceraldehyde 3-phosphate Dehydrogenase	Leaves under salt stress and cold stress Roots under salt or cold stress Drought-treated roots	NA	F:AAGGACTGGAGAGGTGGAAGG R:AGTGCTGCTTGGAATGATGTTG	54	55	SYBR
TUB^[1]	Alpha tubulin-2B	Roots under salt or cold stress Heat-treated leaves	NA	F:ACTGATGTGGCGGTCCTTCTC R:CTGTTGAGGTTGGTGTAGGTTGG	95	55	SYBR
ACT^[1]	Actin7	Roots under salt or cold stress Drought-treated leaves Drought-treated roots Heat-treatedroots	NA	F:TGTTGGATTCTGGTGATGGTGTC R:AGGATGGCGTGCGGAAGG	73	55	SYBR
RPL^[1]	Ribosomal protein L2	Heat-treatedroots	NA	F:GATTGTTCAGGTCGCTGGTG R:CAACAGGTTTCATGGGCACA	127	55	SYBR
PpFEH^[1]	Fructan exohydrolase	Drought and cold stress	NA	F:AGGTTGGGCGGGTATCTATG R:CAGCCTGCACAGTGTCAATT	182	55	SYBR

Name: Huiling Ma
Email: mahl@gsau.edu.cn
Institute: Key Laboratory of Grassland Ecosystem of Ministry of Education, College of Grassland Science, Gansu Agricultural University, Lanzhou, China

Cited by 2 (Based on Google Scholar [2017-08-10])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 Niu K, Shi Y, Ma H. Selection of Candidate Reference Genes for Gene Expression Analysis in Kentucky Bluegrass (Poa pratensis L.) under Abiotic Stress. Front Plant Sci. 2017 Feb 14;8:193. doi: 10.3389/fpls.2017.00193. eCollection 2017. PubMed PMID: 28261247; PubMed Central PMCID: PMC5306334.
↑ Puyang X, An M, Han L, Zhang X. Protective effect of spermidine on salt stress induced oxidative damage in two Kentucky bluegrass (Poa pratensis L.) cultivars. Ecotoxicol Environ Saf. 2015 Jul;117:96-106. doi: 10.1016/j.ecoenv.2015.03.023. Epub 2015 Apr 1. PubMed PMID: 25841065.

@@ Line 111: / Line 111: @@
 *'''Institute''': Key Laboratory of Grassland Ecosystem of Ministry of Education, College of Grassland Science, Gansu Agricultural University, Lanzhou, China
 ===Citation Statistics===
-Cited by '''??''' (Based on Google Scholar [2017-08-01])
+Cited by '''2''' (Based on Google Scholar [2017-08-10])
 =='''References'''==