Difference between revisions of "Posidonia oceanica"

From ICG
Jump to navigation Jump to search
 
(15 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Posidonia oceanica.png|right|200px|link=Posidonia oceanica]]
 +
* '''''Posidonia oceanica''''' is an endemic Mediterranean seagrass, widely distributed along the Mediterranean coasts where it forms large monospecific beds across a wide bathymetric gradient. It has a monoecious mating system and is capable of long-range dispersal by floating fruits. Althouth extremely sensitive to both moderate and high levels of disturbances, P. oceanica meadows can provide key ecological services in the coastal area, including maintenance of marine biodiversity, organic carbon production and export, sediment stabilization and coastal erosion prevention<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Neptune grass'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=55489 <font color=blue>'''NCBI Taxonomy'''</font>]
  
[[File:Posidonia oceanica-1.jpg|right|327px|]]
+
=='''''Abiotic Stress'''''==
* Posidonia oceanica is an endemic Mediterranean seagrass, widely distributed along the Mediterranean coasts where it forms large monospecific beds across a wide bathymetric gradient. P. oceanica meadows provide key ecological services in the coastal area, including maintenance of marine biodiversity, organic carbon production and export, sediment stabilization and coastal erosion prevention.
+
===Internal Control Genes===
* P. oceanica has a monoecious mating system and is capable of long-range dispersal by floating fruits. Sexual reproduction occurs irregularly throughout the whole basin, and very large clones can be found within single meadows. P. oceanica meadows, like other seagrass ecosystems, are extremely sensitive to both moderate and high levels of disturbances often associated with highly human-impacted coasts<ref name="ref1"/> <ref name="ref2"/>.
 
 
 
=='''''Various Abiotic Stresses'''''==
 
===Reference Genes===
 
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 21: Line 21:
 
|align="center"| Ribosomal RNA 18S
 
|align="center"| Ribosomal RNA 18S
 
|
 
|
* Universal reference gene
+
* Salinity Treatment
 +
* PH Treatment
 +
* Light Treatment
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/HM582444 '''AY491942.1 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/HM582444 '''AY491942.1 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 35:
 
|align="center"| Elongation factor 1-alpha
 
|align="center"| Elongation factor 1-alpha
 
|
 
|
* Universal reference gene
+
* Salinity Treatment
 +
* PH Treatment
 +
* Light Treatment
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GO346663 '''GO346663 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GO346663 '''GO346663 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 49:
 
|align="center"| Ubiquitin-conjugating enzyme
 
|align="center"| Ubiquitin-conjugating enzyme
 
|
 
|
* Universal reference gene
+
* Salinity Treatment
 +
* PH Treatment
 +
* Light Treatment
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GO347619 '''GO347619''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GO347619 '''GO347619''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 57: Line 63:
 
|align="center"| Ubiquitin
 
|align="center"| Ubiquitin
 
|
 
|
* Universal reference gene
+
* Salinity Treatment
 +
* PH Treatment
 +
* Light Treatment
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GO347694 '''GO347694''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/GO347694 '''GO347694''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 67: Line 75:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 77: Line 85:
 
*'''Name''': Ilia Anna Serra
 
*'''Name''': Ilia Anna Serra
 
*'''Email''':  gpro@szn.it
 
*'''Email''':  gpro@szn.it
*'''Institute''': Stazione Zoologica Anton Dohrn,Villa Comunale, 80121 Naples, Italy
+
*'''Institution''': Stazione Zoologica Anton Dohrn,Villa Comunale, 80121 Naples, Italy
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''22''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=12887203902658162075&as_sdt=2005&sciodt=0,5&hl=en'''23'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 90: Line 99:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]]
 
[[Category:mRNA]]
 
  
[[Category:SYBR]]
+
=='''Categories'''==
[[Category:18S rRNA]] [[Category:EF1α]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:18S rRNA]][[Category:EF1α]][[Category:Ubiquitin]][[Category:Ubiquitin]][[Category:PH Treatment]]  [[Category:Salinity Treatment]][[Category:Light Treatment]][[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]]

Latest revision as of 07:23, 1 September 2017

Description

Posidonia oceanica.png
  • Posidonia oceanica is an endemic Mediterranean seagrass, widely distributed along the Mediterranean coasts where it forms large monospecific beds across a wide bathymetric gradient. It has a monoecious mating system and is capable of long-range dispersal by floating fruits. Althouth extremely sensitive to both moderate and high levels of disturbances, P. oceanica meadows can provide key ecological services in the coastal area, including maintenance of marine biodiversity, organic carbon production and export, sediment stabilization and coastal erosion prevention[1][2].
  • Common Name: Neptune grass
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S[1] Ribosomal RNA 18S
  • Salinity Treatment
  • PH Treatment
  • Light Treatment
AY491942.1
  • F:AACGAGACCTCAGCCTGCTA
  • R:AAGATTACCCAAGCCTGTCG
200 60 SYBR
EF1A[1] Elongation factor 1-alpha
  • Salinity Treatment
  • PH Treatment
  • Light Treatment
GO346663
  • F:GAGAAGGAAGCTGCTGAAATG
  • R:GAACAGCACAATCAGCCTGAG
214 60 SYBR
NTUBC[1] Ubiquitin-conjugating enzyme
  • Salinity Treatment
  • PH Treatment
  • Light Treatment
GO347619
  • F:TCTGCTCGATTCCGAGTTTT
  • R:GCTTGAAGTCCCTCATCAGC
128 60 SYBR
UBI[1] Ubiquitin
  • Salinity Treatment
  • PH Treatment
  • Light Treatment
GO347694
  • F:CACCCTCGCTGACTACAACA
  • R:TTTCTCAGCCTGACGACCTT
195 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ilia Anna Serra
  • Email: gpro@szn.it
  • Institution: Stazione Zoologica Anton Dohrn,Villa Comunale, 80121 Naples, Italy

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Serra I A, Lauritano C, Dattolo E, et al. Reference genes assessment for the seagrass Posidonia oceanica in different salinity, pH and light conditions[J]. Marine biology, 2012, 159(6): 1269-1282.
  2. Andersen CL, Jensen JL, Orntoft TF (2004) Normalization of realtime quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 64:5245–5250.

Categories