Difference between revisions of "Pyropia yezoensis"

From ICG
Jump to navigation Jump to search
 
(4 intermediate revisions by 2 users not shown)
Line 6: Line 6:
  
 
=='''''Different Developmental Stages & Abiotic Stress'''''==
 
=='''''Different Developmental Stages & Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 80: Line 80:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''7''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=679070025503884953&as_sdt=2005&sciodt=0,5&hl=en'''7'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 91: Line 91:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]]
+
 
[[Category:mRNA]] [[Category:SYBR]]
+
=='''Categories'''==
[[Category:ACT]] [[Category:EF1α]] [[Category:eIF]] [[Category:Ubiquitin]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]][[Category:EF1α]][[Category:eIF]][[Category:Ubiquitin]][[Category:Dehydration Treatment]]  [[Category:Abiotic Stress]][[Category:Air Temperature]][[Category:Different Developmental Stages]][[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]]
[[Category:Dehydration Treatment]]  [[Category:Abiotic Stress]] [[Category:Air Temperature]] [[Category:Different Developmental Stages]]
 

Latest revision as of 07:23, 1 September 2017

Description

Pyropia yezoensis.png
  • Pyropia yezoensis, growing in the intertidal zone, is an economically important seaweed and is widely cultivated in China, Japan, and Korea. It is periodically exposed to air where it experiences a variety of potentially stressful environmental conditions, including nutrient limitation, high light, high and low temperature, desiccation, and osmotic stress[1] [2].
  • Common Name: Red alga
  • NCBI Taxonomy

Different Developmental Stages & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT3[2] Actin3
  • Stress conditions
AB126237
  • F:CAAGCAGAAGGGCATCAT
  • R:CCGAGTAGAAAGCGTGGT
164 60 SYBR
eIF4A[2] Translation initiation factor 4A
  • Different Stress conditions & developmental stages
FJ407185
  • F:GCTTTCTGTCTGGACGAGG
  • R:TCTTCACAAGGATGCGGAT
181 60 SYBR
EF1α[2] Elongation factor 1-α
  • Different Stress conditions & developmental stages
FJ407185
  • F:TTTTGGTGGCACTGCTGAT
  • R:TACACGCACAAGTTGGGGA
141 60 SYBR
UBQ[2] Ubiquitin
  • Different developmental stages
FJ232910
  • F:TTTCCAAGGTGCTCCTCTCCATC
  • R:CGTCTCTTCATAGCGACTGCGGTT
116 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yunxiang Mao
  • Email: yxmao@ouc.edu.cn
  • Institution: College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. Davison IR, Pearson GA (1996) Stress tolerance in intertidal seaweeds. Journal of Phycology 32, 197-211.
  2. 2.0 2.1 2.2 2.3 2.4 Kong F, Cao M, Sun P, Liu W, Mao Y (2014) Selection of reference genes for gene expression normalization in Pyropia yezoensis using quantitative real-time PCR. Journal of Applied Phycology 27, 1003-1010.

Categories