Pyrus pyrifolia

Description

Pear (Pyrus pyrifolia), belonging to the subfamily Maloideae in Rosaceae, Which constitute an economically-significant group of fleshy fruit species important for human diet, dietary diversity and ornamental beauty. The Pyroideae subfamily (to which pear and apple belong) are characterized by the pome fruits which is made up of complex fruiting organs with different expanded tissues derived from the floral tube. It have been cultivated in Europe, East Asia, and North America for up to 3000 years and is commercially grown in about 50 temperate-climate countries^[1]^[2].
Common Name: Nashi pear
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
HIS^[1]	Histone H3	Flower bud, flower organ, fruit flesh and fruit skin	AB824718	F:GTCAAGAAGCCCCACAGATAC R:CTGGAAACGCAGATCAGTCTTG	153	60	SYBR
SAND^[1]	SAND protein	Flower bud, flower organ, fruit flesh and fruit skin	AB824718	F:CCCAGGACTTTGAGCTTTATGC R:TATCACCATGAAAAGGGGCTTG	145	60	SYBR
TIP^[1]	TIP41 protein	Flower bud, flower organ, fruit flesh and fruit skin	AB795983	F:ATCCAAGCATCATCAGCCAAAG R:GGAACAATAACTCTTGCAGGGAGA	113	60	SYBR

Name: Tsuyoshi Imai
Email: imagic@affrc.go.jp
Institution: Plant Physiology and Fruit Chemistry Division, NARO Institute of Fruit Tree Science, Tsukuba, Ibaraki, Japan

Cited by 31 (Based on Google Scholar [2017-08-10])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Imai T, Ubi BE, Saito T, Moriguchi T (2014) Evaluation of reference genes for accurate normalization of gene expression for real time-quantitative PCR in Pyrus pyrifolia using different tissue samples and seasonal conditions. PLoS One 9, e86492.
↑ Wang L, Li XG, Wang L, et al. (2017) Construction of a high-density genetic linkage map in pear (Pyrus communis x Pyrus pyrifolia nakai) using SSRs and SNPs developed by SLAF-seq. Scientia Horticulturae 218, 198-204.