Difference between revisions of "Quercus suber"

From ICG
Jump to navigation Jump to search
 
(11 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Quercus suber.png|right|200px|link=Quercus suber]]
[[File:Quercus suber-1.jpg|right|327px|]]
+
* '''''Quercus suber''''', an evergreen tree characteristic of the Western Mediterranean, has a remarkable capacity to produce suberose tissue, the phellem or cork, with unique properties that make it an excellent material for industrial applications. Due to the ecological and socio-economic significance of this species, large scale transcriptomic projects have been recently launched, targeting specific stress tolerance mechanisms and developmental processes such as cork differentiation<ref name="ref1"/> <ref name="ref2"/>.
* Cork oak (Quercus suber), an evergreen tree characteristic of the Western Mediterranean (Portugal, Spain, Southern France, Italy, North Africa), has a remarkable capacity to produce suberose tissue, the phellem or cork, with unique properties that make it an excellent material for industrial applications. Due to the ecological and socio-economic significance of this species, large scale transcriptomic projects have been recently launched, targeting specific stress tolerance mechanisms and developmental processes such as cork differentiation<ref name="ref1"/> <ref name="ref2"/>.  
+
* <font color=blue>'''Common Name:'''</font> '''Oak''', '''Cork oak'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=58331 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Tissues'''''==
 
=='''''Different Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 20: Line 21:
 
|align="center"| Actin
 
|align="center"| Actin
 
|
 
|
* Different tissues
+
* Leaves, reproduction cork
 +
* Periderm from branches at different developmental stages (1-, 2-, and 3-year old)
 +
* Collected in different dates (active growth period versus dormancy)
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/EU697020 '''EU697020''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/EU697020 '''EU697020''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 32: Line 35:
 
|align="center"| Clathrin adaptor complexes medium subunit family protein
 
|align="center"| Clathrin adaptor complexes medium subunit family protein
 
|
 
|
* Different tissues
+
* Leaves, reproduction cork
 +
* Periderm from branches at different developmental stages (1-, 2-, and 3-year old)
 +
* Collected in different dates (active growth period versus dormancy)
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/6728500 '''6728500''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/6728500 '''6728500''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 42: Line 47:
 
|}
 
|}
  
===Molecular types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 55: Line 60:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''51''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=12638204634143560563&as_sdt=2005&sciodt=0,5&hl=en'''53'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 67: Line 72:
 
</references>
 
</references>
  
[[Category:Plants]]
+
=='''Categories'''==
[[Category:mRNA]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]] [[Category:CACS]][[Category:Different Tissues]][[Category:geNorm]][[Category:NormFinder]][[Category:Delta Ct]]
 
 
[[Category:SYBR]]
 
[[Category:ACT]] [[Category:CACS]]
 
[[Category:Different Tissues]]
 

Latest revision as of 07:25, 1 September 2017

Description

Quercus suber.png
  • Quercus suber, an evergreen tree characteristic of the Western Mediterranean, has a remarkable capacity to produce suberose tissue, the phellem or cork, with unique properties that make it an excellent material for industrial applications. Due to the ecological and socio-economic significance of this species, large scale transcriptomic projects have been recently launched, targeting specific stress tolerance mechanisms and developmental processes such as cork differentiation[1] [2].
  • Common Name: Oak, Cork oak
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Act[1] Actin
  • Leaves, reproduction cork
  • Periderm from branches at different developmental stages (1-, 2-, and 3-year old)
  • Collected in different dates (active growth period versus dormancy)
EU697020
  • F:GCTGGTCGTGATCTAACTG
  • R:CTTTGCAGTCTCCAACTCCT
153 60 SYBR
CACs[1] Clathrin adaptor complexes medium subunit family protein
  • Leaves, reproduction cork
  • Periderm from branches at different developmental stages (1-, 2-, and 3-year old)
  • Collected in different dates (active growth period versus dormancy)
6728500
  • F:TCTGGGAGAAGAGTGGCTACA
  • R:GAGCCACCATTCAAATCCT
175 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Liliana Marum
  • Email: marum@itqb.unl.pt
  • Institution: Instituto de Tecnologia Quı ´mica e Biolo´gica-Universidade Nova de Lisboa (ITQB-UNL), Oeiras, Portugal

Citation Statistics

Cited by 53 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Marum L, Miguel A, Ricardo C P, et al. Reference gene selection for quantitative real-time PCR normalization in Quercus suber[J]. PloS one, 2012, 7(4): e35113.
  2. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, et al. (2009) The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clinical Chemistry 55: 611–622.

Categories