Difference between revisions of "Quercus suber"

From ICG
Jump to navigation Jump to search
Line 60: Line 60:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''51''' (Based on Google Scholar [2017-06-01])
+
Cited by '''52''' (Based on Google Scholar [2017-08-10])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 08:36, 11 August 2017

Description

Quercus suber.png
  • Quercus suber, an evergreen tree characteristic of the Western Mediterranean, has a remarkable capacity to produce suberose tissue, the phellem or cork, with unique properties that make it an excellent material for industrial applications. Due to the ecological and socio-economic significance of this species, large scale transcriptomic projects have been recently launched, targeting specific stress tolerance mechanisms and developmental processes such as cork differentiation[1] [2].
  • Common Name: Oak, Cork oak
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Act[1] Actin
  • Leaves, reproduction cork
  • Periderm from branches at different developmental stages (1-, 2-, and 3-year old)
  • Collected in different dates (active growth period versus dormancy)
EU697020
  • F:GCTGGTCGTGATCTAACTG
  • R:CTTTGCAGTCTCCAACTCCT
153 60 SYBR
CACs[1] Clathrin adaptor complexes medium subunit family protein
  • Leaves, reproduction cork
  • Periderm from branches at different developmental stages (1-, 2-, and 3-year old)
  • Collected in different dates (active growth period versus dormancy)
6728500
  • F:TCTGGGAGAAGAGTGGCTACA
  • R:GAGCCACCATTCAAATCCT
175 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Liliana Marum
  • Email: marum@itqb.unl.pt
  • Institution: Instituto de Tecnologia Quı ´mica e Biolo´gica-Universidade Nova de Lisboa (ITQB-UNL), Oeiras, Portugal

Citation Statistics

Cited by 52 (Based on Google Scholar [2017-08-10])

References

  1. 1.0 1.1 1.2 Marum L, Miguel A, Ricardo C P, et al. Reference gene selection for quantitative real-time PCR normalization in Quercus suber[J]. PloS one, 2012, 7(4): e35113.
  2. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, et al. (2009) The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clinical Chemistry 55: 611–622.

Categories