Difference between revisions of "Raphanus sativus"

From ICG
Jump to navigation Jump to search
 
(18 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Raphanus sativus.png|right|200px|link=Raphanus sativus]]
 +
* '''''Raphanus sativus L.''''', an annual or biennial herb of the Brassicaceae family, is an economically important root vegetable crop produced throughout the world. It is a typical long-day plant and requires vernalization to promote bolting and flowering. The edible part of radish is its taproot, which is an excellent source of carbohydrates, dietary fiber, and essential mineral and organic nutrients to human beings. Radish roots also contain valuable phytochemicals and have been used for many medicinal purposes<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Radish'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3726 <font color=blue>'''NCBI Taxonomy'''</font>]
  
−
[[File:Raphanus sativus-1.jpg|right|327px|]]
+
=='''''Different Tissues & Cultivars & Developmental Stages'''''==
−
* Radish (R. sativus L.) originated in China and is an important root vegetable crop.Radish is a typical long-day plant and requires vernalization to promote bolting and flowering.
+
===Internal Control Genes===
−
* Radish (Raphanus sativus L.) is an annual or biennial herb of the Brassicaceae family, and it is an economically important root vegetable crop produced throughout the world. The edible part of radish is its taproot, which is an excellent source of carbohydrates, dietary fiber, and essential mineral and organic nutrients to human beings . Radish roots also contain valuable phytochemicals and have been used for many medicinal purposes<ref name="ref1"/> <ref name="ref2"/>.
 
−
 
−
=='''''Tissue types & Cultivars & Developmental Stages'''''==
 
−
===Reference Genes===
 
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 21: Line 21:
 
|align="center"| Translation elongation factor 2  
 
|align="center"| Translation elongation factor 2  
 
|
 
|
−
*tissue types；*cultivars；*photoperiodic；*vernalization treatments；* developmental stages
+
*Tissue types
 +
*Cultivars
 +
*Photoperiodic
 +
*Vernalization treatments
 +
*Developmental stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/FY430003 '''FY430003''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/FY430003 '''FY430003''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 37:
 
|align="center"| RNA polymerase-II transcription factor
 
|align="center"| RNA polymerase-II transcription factor
 
|
 
|
−
*tissue types；*cultivars；*photoperiodic；*vernalization treatments；* developmental stages
+
*Tissue types
 +
*Cultivars
 +
*Photoperiodic
 +
*Vernalization treatments
 +
*Developmental stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/FY438464 '''FY438464''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/FY438464 '''FY438464''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 53:
 
|align="center"| Actin 2/7
 
|align="center"| Actin 2/7
 
|
 
|
−
*tissue types；*cultivars；*photoperiodic；*vernalization treatments；* developmental stages
+
*Tissue types
 +
*Cultivars
 +
*Photoperiodic
 +
*Vernalization treatments
 +
*Developmental stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/FY430005 '''FY430005''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/FY430005 '''FY430005''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 54: Line 66:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
−
===Moleculer Types===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 63: Line 76:
 
*'''Name''': Liwang Liu
 
*'''Name''': Liwang Liu
 
*'''Email''': nauliulw@njau.edu.cn
 
*'''Email''': nauliulw@njau.edu.cn
−
*'''Institute''': National Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), Ministry of Agriculture of PR China, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, PR China
+
*'''Institution''': National Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), Ministry of Agriculture of PR China, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, PR China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''50''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=3128533758459439052&as_sdt=2005&sciodt=0,5&hl=en'''54'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 73: Line 87:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
−
Wang Y, Pan Y, Liu Z, et al. De novo transcriptome sequencing of radish (Raphanus sativus L.) and analysis of major genes involved in glucosinolate metabolism. BMC Genomics. 2013;14(1):836. doi:10.1186/1471-2164-14-836. PMCID: PMC4046679
+
Wang Y, Pan Y, Liu Z, et al. De novo transcriptome sequencing of radish (Raphanus sativus L.) and analysis of major genes involved in glucosinolate metabolism. BMC Genomics. 2013;14(1):836. doi:10.1186/1471-2164-14-836. PMCID: PMC4046679.
 
</ref>
 
</ref>
 
</references>
 
</references>
−
[[Category:Plants]]
+
 
 +
=='''Categories'''==
 +
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]][[Category:EF1α]][[Category:polA]][[Category:Different Genotypes]][[Category:Different Tissues]][[Category:Different Developmental Stages]][[Category:geNorm]][[Category:NormFinder]]

Latest revision as of 07:25, 1 September 2017

Description

Raphanus sativus.png
  • Raphanus sativus L., an annual or biennial herb of the Brassicaceae family, is an economically important root vegetable crop produced throughout the world. It is a typical long-day plant and requires vernalization to promote bolting and flowering. The edible part of radish is its taproot, which is an excellent source of carbohydrates, dietary fiber, and essential mineral and organic nutrients to human beings. Radish roots also contain valuable phytochemicals and have been used for many medicinal purposes[1][2].
  • Common Name: Radish
  • NCBI Taxonomy

Different Tissues & Cultivars & Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
TEF2[1] Translation elongation factor 2
  • Tissue types
  • Cultivars
  • Photoperiodic
  • Vernalization treatments
  • Developmental stages
 FY430003
  • F:AAGAAGATTTGGGCGTTTGG
  • R:CCAGCAACAACAGAATCCTT
 107 58 SYBR
RPII[1] RNA polymerase-II transcription factor
  • Tissue types
  • Cultivars
  • Photoperiodic
  • Vernalization treatments
  • Developmental stages
 FY438464
  • F:ATCACGCTAAATGGTCTCCT
  • R:GCTGCTCTCAATCAAGTCAATC
 122 58 SYBR
ACT[1] Actin 2/7
  • Tissue types
  • Cultivars
  • Photoperiodic
  • Vernalization treatments
  • Developmental stages
 FY430005
  • F:GCATCACACTTTCTACAAC
  • R:CCTGGATAGCAACATACAT
 155 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Liwang Liu
  • Email: nauliulw@njau.edu.cn
  • Institution: National Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), Ministry of Agriculture of PR China, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, PR China

Citation Statistics

Cited by 54 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 Xu Y, Zhu X, Gong Y, et al. Evaluation of reference genes for gene expression studies in radish (Raphanus sativus L.) using quantitative real-time PCR[J]. Biochemical and biophysical research communications, 2012, 424(3): 398-403.
  2. ↑ Wang Y, Pan Y, Liu Z, et al. De novo transcriptome sequencing of radish (Raphanus sativus L.) and analysis of major genes involved in glucosinolate metabolism. BMC Genomics. 2013;14(1):836. doi:10.1186/1471-2164-14-836. PMCID: PMC4046679.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Raphanus_sativus&oldid=8774"