Difference between revisions of "Raphanus sativus"

From ICG
Jump to navigation Jump to search
()
Line 67: Line 67:
 
*'''Email''': nauliulw@njau.edu.cn
 
*'''Email''': nauliulw@njau.edu.cn
 
*'''Institution''': National Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), Ministry of Agriculture of PR China, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, PR China
 
*'''Institution''': National Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), Ministry of Agriculture of PR China, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, PR China
−
 
−
=='''References'''==
 
−
<references>
 
−
<ref name="ref1">
 
−
Xu Y, Zhu X, Gong Y, et al. Evaluation of reference genes for gene expression studies in radish (Raphanus sativus L.) using quantitative real-time PCR[J]. Biochemical and biophysical research communications, 2012, 424(3): 398-403.
 
−
</ref>
 
−
</references>
 
  
 
=='''References'''==
 
=='''References'''==

Revision as of 04:27, 17 June 2017

Description

Tissue types & Cultivars　& Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TEF2[1] Translation elongation factor 2
  • tissue types；*cultivars；*photoperiodic；*vernalization treatments；* developmental stages
 FY430003
  • F:AAGAAGATTTGGGCGTTTGG
  • R:CCAGCAACAACAGAATCCTT
 107 58 SYBR
RPII[1] RNA polymerase-II transcription factor
  • tissue types；*cultivars；*photoperiodic；*vernalization treatments；* developmental stages
 FY438464
  • F:ATCACGCTAAATGGTCTCCT
  • R:GCTGCTCTCAATCAAGTCAATC
 122 58 SYBR
ACT[1] Actin 2/7
  • tissue types；*cultivars；*photoperiodic；*vernalization treatments；* developmental stages
 FY430005
  • F:GCATCACACTTTCTACAAC
  • R:CCTGGATAGCAACATACAT
 155 58 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Liwang Liu
  • Email: nauliulw@njau.edu.cn
  • Institute: National Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), Ministry of Agriculture of PR China, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, PR China

Adopted Evaluation Algorithms

Contact

  • Name: Liwang Liu
  • Email: nauliulw@njau.edu.cn
  • Institution: National Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), Ministry of Agriculture of PR China, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, PR China

References

  1. ↑ 1.0 1.1 1.2 Xu Y, Zhu X, Gong Y, et al. Evaluation of reference genes for gene expression studies in radish (Raphanus sativus L.) using quantitative real-time PCR[J]. Biochemical and biophysical research communications, 2012, 424(3): 398-403.
Retrieved from "http://192.168.164.12:9052/index.php?title=Raphanus_sativus&oldid=918"