Difference between revisions of "Raphanus sativus"

Revision as of 04:28, 17 June 2017

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
TEF2^[1]	Translation elongation factor 2	tissue types；cultivars；photoperiodic；vernalization treatments； developmental stages	FY430003	F:AAGAAGATTTGGGCGTTTGG R:CCAGCAACAACAGAATCCTT	107	58	SYBR
RPII^[1]	RNA polymerase-II transcription factor	tissue types；cultivars；photoperiodic；vernalization treatments； developmental stages	FY438464	F:ATCACGCTAAATGGTCTCCT R:GCTGCTCTCAATCAAGTCAATC	122	58	SYBR
ACT^[1]	Actin 2/7	tissue types；cultivars；photoperiodic；vernalization treatments； developmental stages	FY430005	F:GCATCACACTTTCTACAAC R:CCTGGATAGCAACATACAT	155	58	SYBR

Name: Liwang Liu
Email: nauliulw@njau.edu.cn
Institute: National Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), Ministry of Agriculture of PR China, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, PR China

Name: Liwang Liu
Email: nauliulw@njau.edu.cn
Institution: National Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), Ministry of Agriculture of PR China, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, PR China

↑ ^1.0 ^1.1 ^1.2 Xu Y, Zhu X, Gong Y, et al. Evaluation of reference genes for gene expression studies in radish (Raphanus sativus L.) using quantitative real-time PCR[J]. Biochemical and biophysical research communications, 2012, 424(3): 398-403.

@@ Line 1: / Line 1: @@
 =='''Description'''==
-=='''''Tissue types & Cultivars　& Developmental Stages'''''==
+=='''''Tissue types & Cultivars & Developmental Stages'''''==
 ===Reference Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"