Raphanus sativus

Description

Radish (R. sativus L.) originated in China and is an important root vegetable crop.Radish is a typical long-day plant and requires vernalization to promote bolting and flowering.
Radish (Raphanus sativus L.) is an annual or biennial herb of the Brassicaceae family, and it is an economically important root vegetable crop produced throughout the world. The edible part of radish is its taproot, which is an excellent source of carbohydrates, dietary fiber, and essential mineral and organic nutrients to human beings . Radish roots also contain valuable phytochemicals and have been used for many medicinal purposes^[1] ^[2].

Gene Symbol	Gene Name	Application Scope	Accession Number	Primer	Size [bp]	Tm [℃]	Detection
TEF2^[1]	Translation elongation factor 2	tissue types；cultivars；photoperiodic；vernalization treatments； developmental stages	FY430003	F:AAGAAGATTTGGGCGTTTGG R:CCAGCAACAACAGAATCCTT	107	58	SYBR
RPII^[1]	RNA polymerase-II transcription factor	tissue types；cultivars；photoperiodic；vernalization treatments； developmental stages	FY438464	F:ATCACGCTAAATGGTCTCCT R:GCTGCTCTCAATCAAGTCAATC	122	58	SYBR
ACT^[1]	Actin 2/7	tissue types；cultivars；photoperiodic；vernalization treatments； developmental stages	FY430005	F:GCATCACACTTTCTACAAC R:CCTGGATAGCAACATACAT	155	58	SYBR

Name: Liwang Liu
Email: nauliulw@njau.edu.cn
Institute: National Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), Ministry of Agriculture of PR China, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, PR China

↑ ^1.0 ^1.1 ^1.2 ^1.3 Xu Y, Zhu X, Gong Y, et al. Evaluation of reference genes for gene expression studies in radish (Raphanus sativus L.) using quantitative real-time PCR[J]. Biochemical and biophysical research communications, 2012, 424(3): 398-403.
↑ Wang Y, Pan Y, Liu Z, et al. De novo transcriptome sequencing of radish (Raphanus sativus L.) and analysis of major genes involved in glucosinolate metabolism. BMC Genomics. 2013;14(1):836. doi:10.1186/1471-2164-14-836. PMCID: PMC4046679