Difference between revisions of "Rattus norvegicus"
Jump to navigation
Jump to search
ICG Expert1 (talk | contribs) |
|||
Line 151: | Line 151: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GGGTGTGAACCACGAGAAAT | * F:GGGTGTGAACCACGAGAAAT | ||
− | * R: | + | * R:ACTGTGGTCATGAGCCCTTC |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 |
Revision as of 07:39, 21 June 2017
Contents
Eerebral Ischaemia Model
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
Rpl13a[1] | Ribosomal Protein L13A |
|
NM_173340 |
|
NA | 60 | TaqMan |
Sdha[1] | Succinate dehydrogenase complex, subunit A |
|
NM_130428.1 |
|
NA | 60 | TaqMan |
Ywhaz[1] | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide |
|
NM_013011.3 |
|
NA | 60 | TaqMan |
Moleculer Types
- mRNA
Evaluation Methods
Contact
- Name: Judith Mallolas
- Email: jmallolas.girona.ics@gencat.cat
- Institution: Servei de Neurologia, Fundació Privada Institut d'Investigació Biomèdica de Girona Dr. Josep Trueta (IdIBGi), Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain
Citation Statistics
Cited by 79 (Based on Google Scholar [2017-06-16])
Asphyxial Cardiac Arrest Model
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
CypA[2] | Cyclophilin A |
|
M19533 |
|
126 | 86 | SYBR |
Pgk1[2] | Phosphoglycerate kinase 1 |
|
NM_053291 |
|
104 | 81.9 | SYBR |
Gapdh[2] | Glyceraldehyde-3-phosphate dehydrogenase |
|
NM_017008 |
|
118 | 82.9 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
Contact
- Name: Kristina Langnaese
- Email: kristina.langnaese@med.ovgu.de
- Institution: nstitute of Medical Neurobiology, University of Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany
Citation Statistics
Cited by 81 (Based on Google Scholar [2017-06-16])
Cardiosphere-derived Cells
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GAPDH[3] | Glyceraldehyde-3-phosphate dehydrogenase |
|
NM_017008 |
|
NA | 60 | SYBR |
ACTB[3] | β-actin |
|
NM_031144 |
|
NA | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
Contact
- Name: Carolyn A. Carr
- Email: carolyn.carr@dpag.ox.ac.uk
- Institution: Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, Sherrington Building, Parks Road, Oxford OX1 3PT, UK
Citation Statistics
Cited by 50 (Based on Google Scholar [2017-06-16])
Adipose Tissue
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GAPDH[4] | Glyceraldehyde-3-phosphate dehydrogenase |
|
NM_017008.4 |
|
129 | 60 | SYBR |
ACTB[4] | β-actin |
|
NM_031144.3 |
|
150 | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: You-E Yan
- Email: yanyoue@whu.edu.cn
- Institution: Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China
Citation Statistics
Cited by 6 (Based on Google Scholar [2017-06-16])
Intestinal Epithelial Cells
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
Ppib[5] | Peptidylprolyl isomerase B |
|
NM_022536.1 |
|
115 | 60 | SYBR |
Ppia[5] | Peptidyl-prolyl cis–trans isomerase A |
|
NM_017101.1 |
|
127 | 60 | SYBR |
Gapdh[5] | Glyceraldehyde-3-phosphate dehydrogenase |
|
NM_017008.4 |
|
223 | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
Contact
- Name: Maria Sirakov
- Email: maria.sirakov@ulb.ac.be
- Institution: Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium
Citation Statistics
Cited by 4 (Based on Google Scholar [2017-06-16])
Borna Disease Viral Infection
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
ARBP[6] | Acidic ribosomal phosphoprotein P0 |
|
NM_022402 |
|
137 | 60 | SYBR |
ACTB[6] | β-actin |
|
NM_031144 |
|
115 | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Comparative ΔCt method && Related Reference
Contact
- Name: Peng Xie
- Email: xiepeng@cqmu.edu.cn
- Institution: Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China
Citation Statistics
Cited by 10 (Based on Google Scholar [2017-06-16])
Skeletal Muscle
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
RPL13[7] | Ribosomal protein L13 |
|
NM_173340 |
|
110 | 60 | SYBR |
RPL32[7] | Ribosomal protein L32 |
|
NM_013226 |
|
83 | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Ying-yuan Wang
- Email: wyy580218@163.com
- Institution: Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China
Citation Statistics
Cited by 34 (Based on Google Scholar [2017-06-16])
Ischemia & Reperfusion Model
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
hmbs[8] | Hydroxymethylbilane synthase |
|
NM_013168 |
|
76 | 60 | SYBR |
hprt[8] | Phosphoribosyltransferase 1 |
|
NM_012583 |
|
110 | 59 | SYBR |
tbp[8] | TATA binding box protein |
|
NM_001004198 |
|
124 | 58 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
Contact
- Name: Nicoletta Vesentini
- Email: nvesenti@ifc.cnr.it
- Institution: Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article
Citation Statistics
Cited by 14 (Based on Google Scholar [2017-06-16])
References
- ↑ 1.0 1.1 1.2 Gubern C, Hurtado O, Rodríguez R, et al. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia[J]. BMC molecular biology, 2009, 10(1): 57.
- ↑ 2.0 2.1 2.2 Langnaese K, John R, Schweizer H, et al. Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model[J]. BMC molecular biology, 2008, 9(1): 53.
- ↑ 3.0 3.1 Tan S C, Carr C A, Yeoh K K, et al. Identification of valid housekeeping genes for quantitative RT-PCR analysis of cardiosphere-derived cells preconditioned under hypoxia or with prolyl-4-hydroxylase inhibitors[J]. Molecular biology reports, 2012, 39(4): 4857-4867.
- ↑ 4.0 4.1 Zhang W X, Fan J, Ma J, et al. Selection of suitable reference genes for quantitative real-time PCR normalization in three types of rat adipose tissue[J]. International Journal of Molecular Sciences, 2016, 17(6): 968.
- ↑ 5.0 5.1 5.2 Sirakov M, Borra M, Cambuli F M, et al. Defining suitable reference genes for RT-qPCR analysis on intestinal epithelial cells[J]. Molecular biotechnology, 2013, 54(3): 930-938.
- ↑ 6.0 6.1 Zhang L, Liu S, Zhang L, et al. Real-time qPCR identifies suitable reference genes for Borna disease virus-infected rat cortical neurons[J]. International journal of molecular sciences, 2014, 15(12): 21825-21839.
- ↑ 7.0 7.1 Sun J, Nan L, Gao C, et al. Validation of reference genes for estimating wound age in contused rat skeletal muscle by quantitative real-time PCR[J]. International journal of legal medicine, 2012, 126(1): 113-120.
- ↑ 8.0 8.1 8.2 Vesentini N, Barsanti C, Martino A, et al. Selection of reference genes in different myocardial regions of an in vivo ischemia/reperfusion rat model for normalization of antioxidant gene expression[J]. BMC research notes, 2012, 5(1): 124.