Difference between revisions of "Rattus norvegicus"

From ICG
Jump to navigation Jump to search
Line 407: Line 407:
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
! Gene symbol  
+
! Gene Symbol  
! Gene name
+
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
Line 453: Line 453:
 
|}
 
|}
  
===Moleculer types===
+
===Moleculer Types===
 
* mRNA
 
* mRNA
  
Line 463: Line 463:
 
*'''Email''': nvesenti@ifc.cnr.it
 
*'''Email''': nvesenti@ifc.cnr.it
 
*'''Institute''': Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article
 
*'''Institute''': Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article
 +
===Citation Statistics===
 +
Cited by '''14''' (Based on Google Scholar [2017-06-16])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 09:59, 16 June 2017

In-vivo and In-vitro Models of Eerebral Ischaemia

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Rpl13a[1] Ribosomal Protein L13A
  • in-vitro model of cerebral ischaemia
NM_173340
  • F:Rn00821946_g1
  • R:Rn00821946_g1
NA 60 TaqMan
Sdha[1] Succinate dehydrogenase complex, subunit A
  • in-vivo and in-vitro models of cerebral ischaemia
NM_130428.1
  • F:Rn00590475_m1
  • R:Rn00590475_m1
NA 60 TaqMan
Ywhaz[1] Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • in-vivo model of cerebral ischaemia
NM_013011.3
  • F:Rn00755072_m1
  • R:Rn00755072_m1
NA 60 TaqMan

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Judith Mallolas
  • Email: jmallolas.girona.ics@gencat.cat
  • Institute: Servei de Neurologia, Fundació Privada Institut d'Investigació Biomèdica de Girona Dr. Josep Trueta (IdIBGi), Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain

Citation Statistics

Cited by 79 (Based on Google Scholar [2017-06-16])

Rat Asphyxial Cardiac Arrest Model

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CypA[2] cyclophilin A
  • 4 and 21 days post injury
  • 7 days post treatment
M19533
  • F:TATCTGCACTGCCAAGACTGAGTG
  • R:CTTCTTGCTGGTCTTGCCATTCC
126 86 SYBR
Pgk1[2] phosphoglycerate kinase 1
  • 4 and 21 days post injury
NM_053291
  • F:ATGCAAAGACTGGCCAAGCTAC
  • R:AGCCACAGCCTCAGCATATTTC
104 81.9 SYBR
Gapdh[2] glyceraldehyde-3-phosphate dehydrogenase
  • 7 days post injury
NM_017008
  • F:CAACTCCCTCAAGATTGTCAGCAA
  • R:GGCATGGACTGTGGTCATGA
118 82.9 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kristina Langnaese
  • Email: kristina.langnaese@med.ovgu.de
  • Institute: nstitute of Medical Neurobiology, University of Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany

Citation Statistics

Cited by 81 (Based on Google Scholar [2017-06-16])

Cardiosphere-derived Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[3] glyceraldehyde-3-phosphate dehy-drogenase
  • neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
NM_017008
  • F:GGGTGTGAACCACGAGAAAT
  • R:
NA 60 SYBR
Actb[3] Beta-actin
  • neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
NM_031144
  • F:CTAAGGCCAACCGTGAAAAG
  • R:AACACAGCCTGGATGGCTAC
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Carolyn A. Carr
  • Email: carolyn.carr@dpag.ox.ac.uk
  • Institute: Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, Sherrington Building, Parks Road, Oxford OX1 3PT, UK

Citation Statistics

Cited by 50 (Based on Google Scholar [2017-06-16])

Rat Adipose Tissue

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[4] Glyceraldehyde-3-phosphate dehydrogenase
  • eWAT Types of Rat Adipose Tissue
NM_017008.4
  • F:TGCCACTCAGAAGACTGTGG
  • R:TTCAGCTCTGGGATGACCTT
129 60 SYBR
β-actin[4] β-actin
  • iBeAT & BAT Types of Rat Adipose Tissue
NM_031144.3
  • F:ATGGATGACGATATCGCTGC
  • R:CTTCTGACCCATACCCACCA
150 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: You-E Yan
  • Email: yanyoue@whu.edu.cn
  • Institute: Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-16])

Intestinal Epithelial Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Ppib[5] Peptidylprolyl isomerase B

Univeral reference gene in the differentiated fraction

NM_022536.1
  • F:CTGTCGATTCCCTCACAGGT
  • R:AAAATCAGGCCTGTGGAATG
115 60 SYBR
Ppia[5] Peptidyl-prolyl cis–trans isomerase A

proliferating intestinal compartments and IEC6 cells.

NM_017101.1
  • F:AGCATACAGGTCCTGGCATC
  • R:TTCACCTTCCCAAAGACCAC
127 60 SYBR
Gapdh[5] Glyceraldehyde-3-phosphate dehydrogenase

Univeral reference gene in the differentiated fraction

NM_017008.4
  • F:GGCATTGCTCTCAATGACAA
  • R:TGTGAGGGAGATGCTCAGTG
223 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Maria Sirakov
  • Email: maria.sirakov@ulb.ac.be
  • Institute: Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-16])

Borna Disease Virus-Infected Rat Cortical Neurons

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ARBP[6] Acidic ribosomal phosphoprotein P0
  • Day-9-Borna Disease Virus-Infected Rat Cortical Neurons
NM_022402
  • F:TAGAGGGTGTCCGCAATGTG
  • R:CAGTGGGAAGGTGTAGTCAGTC
137 60 SYBR
ACTB[6] Beta-actin
  • Day-12-Borna Disease Virus-Infected Rat Cortical Neurons
NM_031144
  • F:CAGGGTGTGATGGTGGGTATGG
  • R:AGTTGGTGACAATGCCGTGTTC
115 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Peng Xie
  • Email: xiepeng@cqmu.edu.cn
  • Institute: Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-16])

Contused Rat Skeletal Muscle

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPL13[7] ribosomal protein L13

skeletal muscle

NM_173340
  • F:AAGGTGGTGGTTGTACGCTGTG
  • R:CGAGACGGGTTGGTGTTCATCC
110 60 SYBR
RPL32[7] ribosomal protein L32

skeletal muscle

NM_013226
  • F:CACAGCTGGCCATCAGAGTCA
  • R:AAACAGGCACACCAAGCCATCTATTC
83 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ying-yuan Wang
  • Email: wyy580218@163.com
  • Institute: Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China

Citation Statistics

Cited by 34 (Based on Google Scholar [2017-06-16])

In Vivo Ischemia/reperfusion Rat Model

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
hmbs[8] Hydroxymethylbilane synthase
  • right ventricle and Remote region
NM_013168
  • F:TCTAGATGGCTCAGATAGCATGCA
  • R:TGGACCATCTTCTTGCTGAACA
76 60 SYBR
hprt[8] Phosphoribosyltransferase 1
  • right ventricle and Remote region
https://www.ncbi.nlm.nih.gov/nuccore/NM_012583 NM_012583]
  • F:CCCAGCGTCGTGATTAGTGATG
  • R:TTCAGTCCTGTCCATAATCAGTCC
110 59 SYBR
tbp[8] TATA binding box protein
  • right ventricle and Remote region
NM_001004198
  • F:CACCGTGAATCTTGGCTGTAAAC
  • R:CGCAGTTGTTCGTGGCTCTC
124 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Nicoletta Vesentini
  • Email: nvesenti@ifc.cnr.it
  • Institute: Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article

Citation Statistics

Cited by 14 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Gubern C, Hurtado O, Rodríguez R, et al. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia[J]. BMC molecular biology, 2009, 10(1): 57.
  2. 2.0 2.1 2.2 Langnaese K, John R, Schweizer H, et al. Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model[J]. BMC molecular biology, 2008, 9(1): 53.
  3. 3.0 3.1 Tan S C, Carr C A, Yeoh K K, et al. Identification of valid housekeeping genes for quantitative RT-PCR analysis of cardiosphere-derived cells preconditioned under hypoxia or with prolyl-4-hydroxylase inhibitors[J]. Molecular biology reports, 2012, 39(4): 4857-4867.
  4. 4.0 4.1 Zhang W X, Fan J, Ma J, et al. Selection of suitable reference genes for quantitative real-time PCR normalization in three types of rat adipose tissue[J]. International Journal of Molecular Sciences, 2016, 17(6): 968.
  5. 5.0 5.1 5.2 Sirakov M, Borra M, Cambuli F M, et al. Defining suitable reference genes for RT-qPCR analysis on intestinal epithelial cells[J]. Molecular biotechnology, 2013, 54(3): 930-938.
  6. 6.0 6.1 Zhang L, Liu S, Zhang L, et al. Real-time qPCR identifies suitable reference genes for Borna disease virus-infected rat cortical neurons[J]. International journal of molecular sciences, 2014, 15(12): 21825-21839.
  7. 7.0 7.1 Sun J, Nan L, Gao C, et al. Validation of reference genes for estimating wound age in contused rat skeletal muscle by quantitative real-time PCR[J]. International journal of legal medicine, 2012, 126(1): 113-120.
  8. 8.0 8.1 8.2 Vesentini N, Barsanti C, Martino A, et al. Selection of reference genes in different myocardial regions of an in vivo ischemia/reperfusion rat model for normalization of antioxidant gene expression[J]. BMC research notes, 2012, 5(1): 124.