Difference between revisions of "Rattus norvegicus"
Jump to navigation
Jump to search
ICG Expert3 (talk | contribs) |
Wangzhennan (talk | contribs) |
||
(80 intermediate revisions by 7 users not shown) | |||
Line 1: | Line 1: | ||
− | ==''' | + | =='''Description'''== |
+ | [[File:Rattus norvegicus.png|right|200px|link=Rattus norvegicus]] | ||
+ | * '''''Rattus norvegicus''''' is one of the best known and most common rats. Thought to have originated in northern China, this rodent has now spread to all continents except Antarctica, and is the dominant rat in Europe and much of North America—making it by at least this particular definition the most successful mammal on the planet alongside humans [https://en.wikipedia.org/wiki/Brown_rat (Modified from Wikipedia)]. | ||
+ | * <font color=blue>'''Common Name:'''</font> '''Rat''', '''Brown rat''' | ||
+ | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10116 <font color=blue>'''NCBI Taxonomy'''</font>] | ||
− | === | + | =='''''Eerebral Ischaemia Model'''''== |
+ | |||
+ | ===Internal Control Genes=== | ||
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 8: | Line 14: | ||
! style="width:35% font-size:9pt "|Application Scope | ! style="width:35% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 50: | Line 56: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
Line 60: | Line 66: | ||
*'''Name''': Judith Mallolas | *'''Name''': Judith Mallolas | ||
*'''Email''': jmallolas.girona.ics@gencat.cat | *'''Email''': jmallolas.girona.ics@gencat.cat | ||
− | *''' | + | *'''Institution''': Servei de Neurologia, Fundació Privada Institut d'Investigació Biomèdica de Girona Dr. Josep Trueta (IdIBGi), Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain |
+ | |||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=5013758709212631597&as_sdt=2005&sciodt=0,5&hl=en '''82'''] (Based on Google Scholar [2017-09-01]) |
− | ==''' | + | =='''''Asphyxial Cardiac Arrest Model'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 72: | Line 79: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 78: | Line 85: | ||
|- | |- | ||
|align="center"| CypA<ref name="ref2"/> | |align="center"| CypA<ref name="ref2"/> | ||
− | |align="center"| | + | |align="center"| Cyclophilin A |
| | | | ||
* 4 and 21 days post injury | * 4 and 21 days post injury | ||
* 7 days post treatment | * 7 days post treatment | ||
+ | * Treated with the anti-inflammatory and anti-apoptotic drug minocycline | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/M19533 '''M19533 '''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/M19533 '''M19533 '''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 91: | Line 99: | ||
|- | |- | ||
|align="center"| Pgk1<ref name="ref2"/> | |align="center"| Pgk1<ref name="ref2"/> | ||
− | |align="center"| | + | |align="center"| Phosphoglycerate kinase 1 |
| | | | ||
* 4 and 21 days post injury | * 4 and 21 days post injury | ||
+ | * Treated with the anti-inflammatory and anti-apoptotic drug minocycline | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_053291 '''NM_053291'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_053291 '''NM_053291'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 103: | Line 112: | ||
|- | |- | ||
|align="center"| Gapdh<ref name="ref2"/> | |align="center"| Gapdh<ref name="ref2"/> | ||
− | |align="center"| | + | |align="center"| Glyceraldehyde-3-phosphate dehydrogenase |
| | | | ||
* 7 days post injury | * 7 days post injury | ||
+ | * Treated with the anti-inflammatory and anti-apoptotic drug minocycline | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008 '''NM_017008'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008 '''NM_017008'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 114: | Line 124: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
− | === | + | |
+ | ===Molecular Types=== | ||
* mRNA | * mRNA | ||
Line 124: | Line 135: | ||
*'''Name''': Kristina Langnaese | *'''Name''': Kristina Langnaese | ||
*'''Email''': kristina.langnaese@med.ovgu.de | *'''Email''': kristina.langnaese@med.ovgu.de | ||
− | *''' | + | *'''Institution''': nstitute of Medical Neurobiology, University of Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany |
+ | |||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=9456573743372315036&as_sdt=2005&sciodt=0,5&hl=en '''84'''] (Based on Google Scholar [2017-09-01]) |
− | =='''Cardiosphere-derived Cells'''== | + | =='''''Cardiosphere-derived Cells'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 136: | Line 148: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 142: | Line 154: | ||
|- | |- | ||
|align="center"| GAPDH<ref name="ref3"/> | |align="center"| GAPDH<ref name="ref3"/> | ||
− | |align="center"| | + | |align="center"| Glyceraldehyde-3-phosphate dehydrogenase |
| | | | ||
* Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs | * Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs | ||
Line 148: | Line 160: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GGGTGTGAACCACGAGAAAT | * F:GGGTGTGAACCACGAGAAAT | ||
− | * R: | + | * R:ACTGTGGTCATGAGCCCTTC |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 60 | |align="center"| 60 | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|- | |- | ||
− | |align="center"| | + | |align="center"| ACTB<ref name="ref3"/> |
− | |align="center"| | + | |align="center"| β-actin |
| | | | ||
* Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs | * Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs | ||
Line 165: | Line 177: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
− | === | + | |
+ | ===Molecular Types=== | ||
* mRNA | * mRNA | ||
Line 175: | Line 188: | ||
*'''Name''': Carolyn A. Carr | *'''Name''': Carolyn A. Carr | ||
*'''Email''': carolyn.carr@dpag.ox.ac.uk | *'''Email''': carolyn.carr@dpag.ox.ac.uk | ||
− | *''' | + | *'''Institution''': Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, Sherrington Building, Parks Road, Oxford OX1 3PT, UK |
+ | |||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=15278623732676908853&as_sdt=2005&sciodt=0,5&hl=en '''54'''] (Based on Google Scholar [2017-08-10]) |
− | ==''' | + | =='''''Adipose Tissue'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 187: | Line 201: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 195: | Line 209: | ||
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase | |align="center"| Glyceraldehyde-3-phosphate dehydrogenase | ||
| | | | ||
− | * eWAT | + | * eWAT types of rat adipose tissue |
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008.4 '''NM_017008.4'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008.4 '''NM_017008.4'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 204: | Line 218: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|- | |- | ||
− | |align="center"| | + | |align="center"| ACTB<ref name="ref4"/> |
|align="center"| β-actin | |align="center"| β-actin | ||
| | | | ||
− | * iBeAT & BAT | + | * iBeAT & BAT types of rat adipose tissue |
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144.3 '''NM_031144.3'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144.3 '''NM_031144.3'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 216: | Line 230: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
− | === | + | |
+ | ===Molecular Types=== | ||
* mRNA | * mRNA | ||
Line 227: | Line 242: | ||
*'''Name''': You-E Yan | *'''Name''': You-E Yan | ||
*'''Email''': yanyoue@whu.edu.cn | *'''Email''': yanyoue@whu.edu.cn | ||
− | *''' | + | *'''Institution''': Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China |
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=5705193182835038858&as_sdt=2005&sciodt=0,5&hl=en '''8'''] (Based on Google Scholar [2017-09-01]) |
− | =='''Intestinal Epithelial Cells'''== | + | =='''''Intestinal Epithelial Cells'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 239: | Line 254: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 281: | Line 296: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
Line 291: | Line 306: | ||
*'''Name''': Maria Sirakov | *'''Name''': Maria Sirakov | ||
*'''Email''': maria.sirakov@ulb.ac.be | *'''Email''': maria.sirakov@ulb.ac.be | ||
− | *''' | + | *'''Institution''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium |
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=6555526528695445385&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01]) |
− | =='''Borna Disease | + | =='''''Borna Disease Viral Infection'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 304: | Line 319: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 312: | Line 327: | ||
|align="center"| Acidic ribosomal phosphoprotein P0 | |align="center"| Acidic ribosomal phosphoprotein P0 | ||
| | | | ||
− | * Day-9- | + | * Day-9-borna disease virus-infected rat cortical neurons |
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_022402 '''NM_022402'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_022402 '''NM_022402'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 322: | Line 337: | ||
|- | |- | ||
|align="center"| ACTB<ref name="ref6"/> | |align="center"| ACTB<ref name="ref6"/> | ||
− | |align="center"| | + | |align="center"| β-actin |
| | | | ||
− | * Day-12- | + | * Day-12-borna disease virus-infected rat cortical neurons |
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144 '''NM_031144'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144 '''NM_031144'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 333: | Line 348: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
− | === | + | |
+ | ===Molecular Types=== | ||
* mRNA | * mRNA | ||
Line 345: | Line 361: | ||
*'''Name''': Peng Xie | *'''Name''': Peng Xie | ||
*'''Email''': xiepeng@cqmu.edu.cn | *'''Email''': xiepeng@cqmu.edu.cn | ||
− | *''' | + | *'''Institution''': Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China |
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by '''10''' (Based on Google Scholar [2017- | + | Cited by [https://scholar.google.com/scholar?cites=5958914567126320806&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01]) |
− | ==''' | + | =='''''Skeletal Muscle'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 358: | Line 374: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 364: | Line 380: | ||
|- | |- | ||
|align="center"| RPL13<ref name="ref7"/> | |align="center"| RPL13<ref name="ref7"/> | ||
− | |align="center"| | + | |align="center"| Ribosomal protein L13 |
| | | | ||
− | * | + | * Contused rat skeletal muscle |
+ | * Fall 150 cm through a clear Lucite guide tube onto the right posterior limb | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_173340 '''NM_173340 '''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_173340 '''NM_173340 '''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 376: | Line 393: | ||
|- | |- | ||
|align="center"| RPL32<ref name="ref7"/> | |align="center"| RPL32<ref name="ref7"/> | ||
− | |align="center"| | + | |align="center"| Ribosomal protein L32 |
| | | | ||
− | * | + | * Contused rat skeletal muscle |
+ | * Fall 150 cm through a clear Lucite guide tube onto the right posterior limb | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_013226 '''NM_013226'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_013226 '''NM_013226'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
Line 388: | Line 406: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
Line 399: | Line 417: | ||
*'''Name''': Ying-yuan Wang | *'''Name''': Ying-yuan Wang | ||
*'''Email''': wyy580218@163.com | *'''Email''': wyy580218@163.com | ||
− | *''' | + | *'''Institution''': Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China |
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=16823738584799176214&as_sdt=2005&sciodt=0,5&hl=en '''35'''] (Based on Google Scholar [2017-09-01]) |
− | ==''' | + | =='''''Ischemia & Reperfusion Model'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 411: | Line 429: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 432: | Line 450: | ||
| | | | ||
* Right ventricle and Remote region | * Right ventricle and Remote region | ||
− | |align="center"| https://www.ncbi.nlm.nih.gov/nuccore/NM_012583 '''NM_012583'''] | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_012583 '''NM_012583'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:CCCAGCGTCGTGATTAGTGATG | * F:CCCAGCGTCGTGATTAGTGATG | ||
Line 453: | Line 471: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
* mRNA | * mRNA | ||
Line 462: | Line 480: | ||
*'''Name''': Nicoletta Vesentini | *'''Name''': Nicoletta Vesentini | ||
*'''Email''': nvesenti@ifc.cnr.it | *'''Email''': nvesenti@ifc.cnr.it | ||
− | *''' | + | *'''Institution''': Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article |
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=18111341012430965555&as_sdt=2005&sciodt=0,5&hl=en '''15'''] (Based on Google Scholar [2017-09-01]) |
=='''References'''== | =='''References'''== | ||
Line 501: | Line 519: | ||
</ref> | </ref> | ||
</references> | </references> | ||
+ | |||
+ | =='''Categories'''== | ||
[[Category:Animals]] | [[Category:Animals]] | ||
[[Category:mRNA]] | [[Category:mRNA]] | ||
[[Category:SYBR]] | [[Category:SYBR]] | ||
− | [[Category: | + | [[Category:TaqMan]] |
+ | [[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:ARBP]] [[Category:Cyclophilin]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:HMBS]] [[Category:HPRT]] [[Category:PGK]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:SDHA]] [[Category:TBP]] [[Category:YWHAZ]] | ||
+ | [[Category:Specific Tissue]] [[Category:Animal Model]] [[Category:Viral Infection]] [[Category:Cortical Neurons]] [[Category:Specific Cells]] [[Category:Skeletal Muscle]] [[Category:Biotic Stress]] [[Category:Pathological conditions]] | ||
+ | {{Template:BackToTop}} | ||
+ | [[Category:geNorm]] | ||
+ | [[Category:NormFinder]] | ||
+ | [[Category:BestKeeper]] | ||
+ | [[Category:Delta Ct]] | ||
+ | [[Category:RefFinder]] |
Latest revision as of 14:20, 7 September 2017
Contents
Description
- Rattus norvegicus is one of the best known and most common rats. Thought to have originated in northern China, this rodent has now spread to all continents except Antarctica, and is the dominant rat in Europe and much of North America—making it by at least this particular definition the most successful mammal on the planet alongside humans (Modified from Wikipedia).
- Common Name: Rat, Brown rat
- NCBI Taxonomy
Eerebral Ischaemia Model
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
Rpl13a[1] | Ribosomal Protein L13A |
|
NM_173340 |
|
NA | 60 | TaqMan |
Sdha[1] | Succinate dehydrogenase complex, subunit A |
|
NM_130428.1 |
|
NA | 60 | TaqMan |
Ywhaz[1] | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide |
|
NM_013011.3 |
|
NA | 60 | TaqMan |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Judith Mallolas
- Email: jmallolas.girona.ics@gencat.cat
- Institution: Servei de Neurologia, Fundació Privada Institut d'Investigació Biomèdica de Girona Dr. Josep Trueta (IdIBGi), Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain
Citation Statistics
Cited by 82 (Based on Google Scholar [2017-09-01])
Asphyxial Cardiac Arrest Model
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
CypA[2] | Cyclophilin A |
|
M19533 |
|
126 | 86 | SYBR |
Pgk1[2] | Phosphoglycerate kinase 1 |
|
NM_053291 |
|
104 | 81.9 | SYBR |
Gapdh[2] | Glyceraldehyde-3-phosphate dehydrogenase |
|
NM_017008 |
|
118 | 82.9 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Kristina Langnaese
- Email: kristina.langnaese@med.ovgu.de
- Institution: nstitute of Medical Neurobiology, University of Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany
Citation Statistics
Cited by 84 (Based on Google Scholar [2017-09-01])
Cardiosphere-derived Cells
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GAPDH[3] | Glyceraldehyde-3-phosphate dehydrogenase |
|
NM_017008 |
|
NA | 60 | SYBR |
ACTB[3] | β-actin |
|
NM_031144 |
|
NA | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Carolyn A. Carr
- Email: carolyn.carr@dpag.ox.ac.uk
- Institution: Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, Sherrington Building, Parks Road, Oxford OX1 3PT, UK
Citation Statistics
Cited by 54 (Based on Google Scholar [2017-08-10])
Adipose Tissue
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GAPDH[4] | Glyceraldehyde-3-phosphate dehydrogenase |
|
NM_017008.4 |
|
129 | 60 | SYBR |
ACTB[4] | β-actin |
|
NM_031144.3 |
|
150 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: You-E Yan
- Email: yanyoue@whu.edu.cn
- Institution: Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China
Citation Statistics
Cited by 8 (Based on Google Scholar [2017-09-01])
Intestinal Epithelial Cells
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
Ppib[5] | Peptidylprolyl isomerase B |
|
NM_022536.1 |
|
115 | 60 | SYBR |
Ppia[5] | Peptidyl-prolyl cis–trans isomerase A |
|
NM_017101.1 |
|
127 | 60 | SYBR |
Gapdh[5] | Glyceraldehyde-3-phosphate dehydrogenase |
|
NM_017008.4 |
|
223 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Maria Sirakov
- Email: maria.sirakov@ulb.ac.be
- Institution: Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium
Citation Statistics
Cited by 5 (Based on Google Scholar [2017-09-01])
Borna Disease Viral Infection
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
ARBP[6] | Acidic ribosomal phosphoprotein P0 |
|
NM_022402 |
|
137 | 60 | SYBR |
ACTB[6] | β-actin |
|
NM_031144 |
|
115 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Comparative ΔCt method && Related Reference
Contact
- Name: Peng Xie
- Email: xiepeng@cqmu.edu.cn
- Institution: Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China
Citation Statistics
Cited by 10 (Based on Google Scholar [2017-09-01])
Skeletal Muscle
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
RPL13[7] | Ribosomal protein L13 |
|
NM_173340 |
|
110 | 60 | SYBR |
RPL32[7] | Ribosomal protein L32 |
|
NM_013226 |
|
83 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Ying-yuan Wang
- Email: wyy580218@163.com
- Institution: Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China
Citation Statistics
Cited by 35 (Based on Google Scholar [2017-09-01])
Ischemia & Reperfusion Model
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
hmbs[8] | Hydroxymethylbilane synthase |
|
NM_013168 |
|
76 | 60 | SYBR |
hprt[8] | Phosphoribosyltransferase 1 |
|
NM_012583 |
|
110 | 59 | SYBR |
tbp[8] | TATA binding box protein |
|
NM_001004198 |
|
124 | 58 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Nicoletta Vesentini
- Email: nvesenti@ifc.cnr.it
- Institution: Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article
Citation Statistics
Cited by 15 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 Gubern C, Hurtado O, Rodríguez R, et al. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia[J]. BMC molecular biology, 2009, 10(1): 57.
- ↑ 2.0 2.1 2.2 Langnaese K, John R, Schweizer H, et al. Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model[J]. BMC molecular biology, 2008, 9(1): 53.
- ↑ 3.0 3.1 Tan S C, Carr C A, Yeoh K K, et al. Identification of valid housekeeping genes for quantitative RT-PCR analysis of cardiosphere-derived cells preconditioned under hypoxia or with prolyl-4-hydroxylase inhibitors[J]. Molecular biology reports, 2012, 39(4): 4857-4867.
- ↑ 4.0 4.1 Zhang W X, Fan J, Ma J, et al. Selection of suitable reference genes for quantitative real-time PCR normalization in three types of rat adipose tissue[J]. International Journal of Molecular Sciences, 2016, 17(6): 968.
- ↑ 5.0 5.1 5.2 Sirakov M, Borra M, Cambuli F M, et al. Defining suitable reference genes for RT-qPCR analysis on intestinal epithelial cells[J]. Molecular biotechnology, 2013, 54(3): 930-938.
- ↑ 6.0 6.1 Zhang L, Liu S, Zhang L, et al. Real-time qPCR identifies suitable reference genes for Borna disease virus-infected rat cortical neurons[J]. International journal of molecular sciences, 2014, 15(12): 21825-21839.
- ↑ 7.0 7.1 Sun J, Nan L, Gao C, et al. Validation of reference genes for estimating wound age in contused rat skeletal muscle by quantitative real-time PCR[J]. International journal of legal medicine, 2012, 126(1): 113-120.
- ↑ 8.0 8.1 8.2 Vesentini N, Barsanti C, Martino A, et al. Selection of reference genes in different myocardial regions of an in vivo ischemia/reperfusion rat model for normalization of antioxidant gene expression[J]. BMC research notes, 2012, 5(1): 124.
Categories