Difference between revisions of "Rattus norvegicus"

From ICG
Jump to navigation Jump to search
 
(42 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 +
=='''Description'''==
 +
[[File:Rattus norvegicus.png|right|200px|link=Rattus norvegicus]]
 +
* '''''Rattus norvegicus''''' is one of the best known and most common rats. Thought to have originated in northern China, this rodent has now spread to all continents except Antarctica, and is the dominant rat in Europe and much of North America—making it by at least this particular definition the most successful mammal on the planet alongside humans [https://en.wikipedia.org/wiki/Brown_rat (Modified from Wikipedia)].
 +
* <font color=blue>'''Common Name:'''</font> '''Rat''', '''Brown rat'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10116 <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
=='''''Eerebral Ischaemia Model'''''==
 
=='''''Eerebral Ischaemia Model'''''==
  
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 63: Line 69:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''79''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=5013758709212631597&as_sdt=2005&sciodt=0,5&hl=en '''82'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Asphyxial Cardiac Arrest Model'''''==
 
=='''''Asphyxial Cardiac Arrest Model'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 83: Line 89:
 
* 4 and 21 days post injury
 
* 4 and 21 days post injury
 
* 7 days post treatment
 
* 7 days post treatment
 +
* Treated with the anti-inflammatory and anti-apoptotic drug minocycline
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/M19533 '''M19533 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/M19533 '''M19533 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 95: Line 102:
 
|
 
|
 
* 4 and 21 days post injury
 
* 4 and 21 days post injury
 +
* Treated with the anti-inflammatory and anti-apoptotic drug minocycline
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_053291 '''NM_053291''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_053291 '''NM_053291''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 107: Line 115:
 
|
 
|
 
* 7 days post injury
 
* 7 days post injury
 +
* Treated with the anti-inflammatory and anti-apoptotic drug minocycline
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008 '''NM_017008''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008 '''NM_017008''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 129: Line 138:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''81''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=9456573743372315036&as_sdt=2005&sciodt=0,5&hl=en '''84'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Cardiosphere-derived Cells'''''==
 
=='''''Cardiosphere-derived Cells'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 182: Line 191:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''50''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=15278623732676908853&as_sdt=2005&sciodt=0,5&hl=en '''54'''] (Based on Google Scholar [2017-08-10])
  
 
=='''''Adipose Tissue'''''==
 
=='''''Adipose Tissue'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 235: Line 244:
 
*'''Institution''': Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China
 
*'''Institution''': Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''6''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=5705193182835038858&as_sdt=2005&sciodt=0,5&hl=en '''8'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Intestinal Epithelial Cells'''''==
 
=='''''Intestinal Epithelial Cells'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 299: Line 308:
 
*'''Institution''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium
 
*'''Institution''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''4''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=6555526528695445385&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Borna Disease Viral Infection'''''==
 
=='''''Borna Disease Viral Infection'''''==
  
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 340: Line 349:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 354: Line 363:
 
*'''Institution''': Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China
 
*'''Institution''': Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''10''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=5958914567126320806&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Skeletal Muscle'''''==
 
=='''''Skeletal Muscle'''''==
  
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 373: Line 382:
 
|align="center"| Ribosomal protein L13
 
|align="center"| Ribosomal protein L13
 
|
 
|
*Contused rat skeletal muscle
+
* Contused rat skeletal muscle
 +
* Fall 150 cm through a clear Lucite guide tube onto the right posterior limb
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_173340 '''NM_173340 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_173340 '''NM_173340 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 385: Line 395:
 
|align="center"| Ribosomal protein L32
 
|align="center"| Ribosomal protein L32
 
|
 
|
*Contused rat skeletal muscle
+
* Contused rat skeletal muscle
 +
* Fall 150 cm through a clear Lucite guide tube onto the right posterior limb
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013226 '''NM_013226''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013226 '''NM_013226''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 395: Line 406:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 408: Line 419:
 
*'''Institution''': Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China
 
*'''Institution''': Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''34''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16823738584799176214&as_sdt=2005&sciodt=0,5&hl=en '''35'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Ischemia & Reperfusion Model'''''==
 
=='''''Ischemia & Reperfusion Model'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 460: Line 471:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 471: Line 482:
 
*'''Institution''': Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article
 
*'''Institution''': Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''14''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=18111341012430965555&as_sdt=2005&sciodt=0,5&hl=en '''15'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 508: Line 519:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:TaqMan]]
 
[[Category:TaqMan]]
[[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:ARBP]] [[Category:CYC]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:HMBS]] [[Category:HPRT]] [[Category:PGK]] [[Category:PPI]] [[Category:PPI]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:SDHA]] [[Category:TBP]] [[Category:YWHAZ]]
+
[[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:ARBP]] [[Category:Cyclophilin]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:HMBS]] [[Category:HPRT]] [[Category:PGK]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:SDHA]] [[Category:TBP]] [[Category:YWHAZ]]
 
[[Category:Specific Tissue]]  [[Category:Animal Model]]  [[Category:Viral Infection]]  [[Category:Cortical Neurons]]  [[Category:Specific Cells]]  [[Category:Skeletal Muscle]]  [[Category:Biotic Stress]]  [[Category:Pathological conditions]]
 
[[Category:Specific Tissue]]  [[Category:Animal Model]]  [[Category:Viral Infection]]  [[Category:Cortical Neurons]]  [[Category:Specific Cells]]  [[Category:Skeletal Muscle]]  [[Category:Biotic Stress]]  [[Category:Pathological conditions]]
 +
{{Template:BackToTop}}
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 14:20, 7 September 2017

Description

Rattus norvegicus.png
  • Rattus norvegicus is one of the best known and most common rats. Thought to have originated in northern China, this rodent has now spread to all continents except Antarctica, and is the dominant rat in Europe and much of North America—making it by at least this particular definition the most successful mammal on the planet alongside humans (Modified from Wikipedia).
  • Common Name: Rat, Brown rat
  • NCBI Taxonomy

Eerebral Ischaemia Model

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Rpl13a[1] Ribosomal Protein L13A
  • In-vitro model of cerebral ischaemia
NM_173340
  • F:Rn00821946_g1
  • R:Rn00821946_g1
NA 60 TaqMan
Sdha[1] Succinate dehydrogenase complex, subunit A
  • In-vivo and in-vitro models of cerebral ischaemia
NM_130428.1
  • F:Rn00590475_m1
  • R:Rn00590475_m1
NA 60 TaqMan
Ywhaz[1] Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
  • In-vivo model of cerebral ischaemia
NM_013011.3
  • F:Rn00755072_m1
  • R:Rn00755072_m1
NA 60 TaqMan

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Judith Mallolas
  • Email: jmallolas.girona.ics@gencat.cat
  • Institution: Servei de Neurologia, Fundació Privada Institut d'Investigació Biomèdica de Girona Dr. Josep Trueta (IdIBGi), Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain

Citation Statistics

Cited by 82 (Based on Google Scholar [2017-09-01])

Asphyxial Cardiac Arrest Model

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
CypA[2] Cyclophilin A
  • 4 and 21 days post injury
  • 7 days post treatment
  • Treated with the anti-inflammatory and anti-apoptotic drug minocycline
M19533
  • F:TATCTGCACTGCCAAGACTGAGTG
  • R:CTTCTTGCTGGTCTTGCCATTCC
126 86 SYBR
Pgk1[2] Phosphoglycerate kinase 1
  • 4 and 21 days post injury
  • Treated with the anti-inflammatory and anti-apoptotic drug minocycline
NM_053291
  • F:ATGCAAAGACTGGCCAAGCTAC
  • R:AGCCACAGCCTCAGCATATTTC
104 81.9 SYBR
Gapdh[2] Glyceraldehyde-3-phosphate dehydrogenase
  • 7 days post injury
  • Treated with the anti-inflammatory and anti-apoptotic drug minocycline
NM_017008
  • F:CAACTCCCTCAAGATTGTCAGCAA
  • R:GGCATGGACTGTGGTCATGA
118 82.9 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kristina Langnaese
  • Email: kristina.langnaese@med.ovgu.de
  • Institution: nstitute of Medical Neurobiology, University of Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany

Citation Statistics

Cited by 84 (Based on Google Scholar [2017-09-01])

Cardiosphere-derived Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[3] Glyceraldehyde-3-phosphate dehydrogenase
  • Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
NM_017008
  • F:GGGTGTGAACCACGAGAAAT
  • R:ACTGTGGTCATGAGCCCTTC
NA 60 SYBR
ACTB[3] β-actin
  • Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
NM_031144
  • F:CTAAGGCCAACCGTGAAAAG
  • R:AACACAGCCTGGATGGCTAC
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Carolyn A. Carr
  • Email: carolyn.carr@dpag.ox.ac.uk
  • Institution: Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, Sherrington Building, Parks Road, Oxford OX1 3PT, UK

Citation Statistics

Cited by 54 (Based on Google Scholar [2017-08-10])

Adipose Tissue

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[4] Glyceraldehyde-3-phosphate dehydrogenase
  • eWAT types of rat adipose tissue
NM_017008.4
  • F:TGCCACTCAGAAGACTGTGG
  • R:TTCAGCTCTGGGATGACCTT
129 60 SYBR
ACTB[4] β-actin
  • iBeAT & BAT types of rat adipose tissue
NM_031144.3
  • F:ATGGATGACGATATCGCTGC
  • R:CTTCTGACCCATACCCACCA
150 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: You-E Yan
  • Email: yanyoue@whu.edu.cn
  • Institution: Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])

Intestinal Epithelial Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ppib[5] Peptidylprolyl isomerase B
  • Univeral reference gene in the differentiated fraction
NM_022536.1
  • F:CTGTCGATTCCCTCACAGGT
  • R:AAAATCAGGCCTGTGGAATG
115 60 SYBR
Ppia[5] Peptidyl-prolyl cis–trans isomerase A
  • Proliferating intestinal compartments and IEC6 cells.
NM_017101.1
  • F:AGCATACAGGTCCTGGCATC
  • R:TTCACCTTCCCAAAGACCAC
127 60 SYBR
Gapdh[5] Glyceraldehyde-3-phosphate dehydrogenase
  • Univeral reference gene in the differentiated fraction
NM_017008.4
  • F:GGCATTGCTCTCAATGACAA
  • R:TGTGAGGGAGATGCTCAGTG
223 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Maria Sirakov
  • Email: maria.sirakov@ulb.ac.be
  • Institution: Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

Borna Disease Viral Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ARBP[6] Acidic ribosomal phosphoprotein P0
  • Day-9-borna disease virus-infected rat cortical neurons
NM_022402
  • F:TAGAGGGTGTCCGCAATGTG
  • R:CAGTGGGAAGGTGTAGTCAGTC
137 60 SYBR
ACTB[6] β-actin
  • Day-12-borna disease virus-infected rat cortical neurons
NM_031144
  • F:CAGGGTGTGATGGTGGGTATGG
  • R:AGTTGGTGACAATGCCGTGTTC
115 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Peng Xie
  • Email: xiepeng@cqmu.edu.cn
  • Institution: Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Skeletal Muscle

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL13[7] Ribosomal protein L13
  • Contused rat skeletal muscle
  • Fall 150 cm through a clear Lucite guide tube onto the right posterior limb
NM_173340
  • F:AAGGTGGTGGTTGTACGCTGTG
  • R:CGAGACGGGTTGGTGTTCATCC
110 60 SYBR
RPL32[7] Ribosomal protein L32
  • Contused rat skeletal muscle
  • Fall 150 cm through a clear Lucite guide tube onto the right posterior limb
NM_013226
  • F:CACAGCTGGCCATCAGAGTCA
  • R:AAACAGGCACACCAAGCCATCTATTC
83 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ying-yuan Wang
  • Email: wyy580218@163.com
  • Institution: Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China

Citation Statistics

Cited by 35 (Based on Google Scholar [2017-09-01])

Ischemia & Reperfusion Model

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
hmbs[8] Hydroxymethylbilane synthase
  • Right ventricle and Remote region
NM_013168
  • F:TCTAGATGGCTCAGATAGCATGCA
  • R:TGGACCATCTTCTTGCTGAACA
76 60 SYBR
hprt[8] Phosphoribosyltransferase 1
  • Right ventricle and Remote region
NM_012583
  • F:CCCAGCGTCGTGATTAGTGATG
  • R:TTCAGTCCTGTCCATAATCAGTCC
110 59 SYBR
tbp[8] TATA binding box protein
  • Right ventricle and Remote region
NM_001004198
  • F:CACCGTGAATCTTGGCTGTAAAC
  • R:CGCAGTTGTTCGTGGCTCTC
124 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Nicoletta Vesentini
  • Email: nvesenti@ifc.cnr.it
  • Institution: Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Gubern C, Hurtado O, Rodríguez R, et al. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia[J]. BMC molecular biology, 2009, 10(1): 57.
  2. 2.0 2.1 2.2 Langnaese K, John R, Schweizer H, et al. Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model[J]. BMC molecular biology, 2008, 9(1): 53.
  3. 3.0 3.1 Tan S C, Carr C A, Yeoh K K, et al. Identification of valid housekeeping genes for quantitative RT-PCR analysis of cardiosphere-derived cells preconditioned under hypoxia or with prolyl-4-hydroxylase inhibitors[J]. Molecular biology reports, 2012, 39(4): 4857-4867.
  4. 4.0 4.1 Zhang W X, Fan J, Ma J, et al. Selection of suitable reference genes for quantitative real-time PCR normalization in three types of rat adipose tissue[J]. International Journal of Molecular Sciences, 2016, 17(6): 968.
  5. 5.0 5.1 5.2 Sirakov M, Borra M, Cambuli F M, et al. Defining suitable reference genes for RT-qPCR analysis on intestinal epithelial cells[J]. Molecular biotechnology, 2013, 54(3): 930-938.
  6. 6.0 6.1 Zhang L, Liu S, Zhang L, et al. Real-time qPCR identifies suitable reference genes for Borna disease virus-infected rat cortical neurons[J]. International journal of molecular sciences, 2014, 15(12): 21825-21839.
  7. 7.0 7.1 Sun J, Nan L, Gao C, et al. Validation of reference genes for estimating wound age in contused rat skeletal muscle by quantitative real-time PCR[J]. International journal of legal medicine, 2012, 126(1): 113-120.
  8. 8.0 8.1 8.2 Vesentini N, Barsanti C, Martino A, et al. Selection of reference genes in different myocardial regions of an in vivo ischemia/reperfusion rat model for normalization of antioxidant gene expression[J]. BMC research notes, 2012, 5(1): 124.

Categories