Difference between revisions of "Rattus norvegicus"

Latest revision as of 14:20, 7 September 2017

Description

Rattus norvegicus is one of the best known and most common rats. Thought to have originated in northern China, this rodent has now spread to all continents except Antarctica, and is the dominant rat in Europe and much of North America—making it by at least this particular definition the most successful mammal on the planet alongside humans (Modified from Wikipedia).
Common Name: Rat, Brown rat
NCBI Taxonomy

Eerebral Ischaemia Model

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Rpl13a^[1]	Ribosomal Protein L13A	In-vitro model of cerebral ischaemia	NM_173340	F:Rn00821946_g1 R:Rn00821946_g1	NA	60	TaqMan
Sdha^[1]	Succinate dehydrogenase complex, subunit A	In-vivo and in-vitro models of cerebral ischaemia	NM_130428.1	F:Rn00590475_m1 R:Rn00590475_m1	NA	60	TaqMan
Ywhaz^[1]	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	In-vivo model of cerebral ischaemia	NM_013011.3	F:Rn00755072_m1 R:Rn00755072_m1	NA	60	TaqMan

Molecular Types

mRNA

Evaluation Methods

Contact

Name: Judith Mallolas
Email: jmallolas.girona.ics@gencat.cat
Institution: Servei de Neurologia, Fundació Privada Institut d'Investigació Biomèdica de Girona Dr. Josep Trueta (IdIBGi), Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain

Citation Statistics

Cited by 82 (Based on Google Scholar [2017-09-01])

Asphyxial Cardiac Arrest Model

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
CypA^[2]	Cyclophilin A	4 and 21 days post injury 7 days post treatment Treated with the anti-inflammatory and anti-apoptotic drug minocycline	M19533	F:TATCTGCACTGCCAAGACTGAGTG R:CTTCTTGCTGGTCTTGCCATTCC	126	86	SYBR
Pgk1^[2]	Phosphoglycerate kinase 1	4 and 21 days post injury Treated with the anti-inflammatory and anti-apoptotic drug minocycline	NM_053291	F:ATGCAAAGACTGGCCAAGCTAC R:AGCCACAGCCTCAGCATATTTC	104	81.9	SYBR
Gapdh^[2]	Glyceraldehyde-3-phosphate dehydrogenase	7 days post injury Treated with the anti-inflammatory and anti-apoptotic drug minocycline	NM_017008	F:CAACTCCCTCAAGATTGTCAGCAA R:GGCATGGACTGTGGTCATGA	118	82.9	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: Kristina Langnaese
Email: kristina.langnaese@med.ovgu.de
Institution: nstitute of Medical Neurobiology, University of Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany

Citation Statistics

Cited by 84 (Based on Google Scholar [2017-09-01])

Cardiosphere-derived Cells

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
GAPDH^[3]	Glyceraldehyde-3-phosphate dehydrogenase	Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs	NM_017008	F:GGGTGTGAACCACGAGAAAT R:ACTGTGGTCATGAGCCCTTC	NA	60	SYBR
ACTB^[3]	β-actin	Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs	NM_031144	F:CTAAGGCCAACCGTGAAAAG R:AACACAGCCTGGATGGCTAC	NA	60	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: Carolyn A. Carr
Email: carolyn.carr@dpag.ox.ac.uk
Institution: Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, Sherrington Building, Parks Road, Oxford OX1 3PT, UK

Citation Statistics

Cited by 54 (Based on Google Scholar [2017-08-10])

Adipose Tissue

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
GAPDH^[4]	Glyceraldehyde-3-phosphate dehydrogenase	eWAT types of rat adipose tissue	NM_017008.4	F:TGCCACTCAGAAGACTGTGG R:TTCAGCTCTGGGATGACCTT	129	60	SYBR
ACTB^[4]	β-actin	iBeAT & BAT types of rat adipose tissue	NM_031144.3	F:ATGGATGACGATATCGCTGC R:CTTCTGACCCATACCCACCA	150	60	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: You-E Yan
Email: yanyoue@whu.edu.cn
Institution: Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])

Intestinal Epithelial Cells

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Ppib^[5]	Peptidylprolyl isomerase B	Univeral reference gene in the differentiated fraction	NM_022536.1	F:CTGTCGATTCCCTCACAGGT R:AAAATCAGGCCTGTGGAATG	115	60	SYBR
Ppia^[5]	Peptidyl-prolyl cis–trans isomerase A	Proliferating intestinal compartments and IEC6 cells.	NM_017101.1	F:AGCATACAGGTCCTGGCATC R:TTCACCTTCCCAAAGACCAC	127	60	SYBR
Gapdh^[5]	Glyceraldehyde-3-phosphate dehydrogenase	Univeral reference gene in the differentiated fraction	NM_017008.4	F:GGCATTGCTCTCAATGACAA R:TGTGAGGGAGATGCTCAGTG	223	60	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: Maria Sirakov
Email: maria.sirakov@ulb.ac.be
Institution: Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

Borna Disease Viral Infection

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
ARBP^[6]	Acidic ribosomal phosphoprotein P0	Day-9-borna disease virus-infected rat cortical neurons	NM_022402	F:TAGAGGGTGTCCGCAATGTG R:CAGTGGGAAGGTGTAGTCAGTC	137	60	SYBR
ACTB^[6]	β-actin	Day-12-borna disease virus-infected rat cortical neurons	NM_031144	F:CAGGGTGTGATGGTGGGTATGG R:AGTTGGTGACAATGCCGTGTTC	115	60	SYBR

Molecular Types

mRNA

Evaluation Methods

geNorm method && Related Reference
NormFinder method && Related Reference
BestKeeper method && Related Reference
Comparative ΔCt method && Related Reference

Contact

Name: Peng Xie
Email: xiepeng@cqmu.edu.cn
Institution: Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

Skeletal Muscle

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
RPL13^[7]	Ribosomal protein L13	Contused rat skeletal muscle Fall 150 cm through a clear Lucite guide tube onto the right posterior limb	NM_173340	F:AAGGTGGTGGTTGTACGCTGTG R:CGAGACGGGTTGGTGTTCATCC	110	60	SYBR
RPL32^[7]	Ribosomal protein L32	Contused rat skeletal muscle Fall 150 cm through a clear Lucite guide tube onto the right posterior limb	NM_013226	F:CACAGCTGGCCATCAGAGTCA R:AAACAGGCACACCAAGCCATCTATTC	83	60	SYBR

Molecular Types

mRNA

Evaluation Methods

Contact

Name: Ying-yuan Wang
Email: wyy580218@163.com
Institution: Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China

Citation Statistics

Cited by 35 (Based on Google Scholar [2017-09-01])

Ischemia & Reperfusion Model

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
hmbs^[8]	Hydroxymethylbilane synthase	Right ventricle and Remote region	NM_013168	F:TCTAGATGGCTCAGATAGCATGCA R:TGGACCATCTTCTTGCTGAACA	76	60	SYBR
hprt^[8]	Phosphoribosyltransferase 1	Right ventricle and Remote region	NM_012583	F:CCCAGCGTCGTGATTAGTGATG R:TTCAGTCCTGTCCATAATCAGTCC	110	59	SYBR
tbp^[8]	TATA binding box protein	Right ventricle and Remote region	NM_001004198	F:CACCGTGAATCTTGGCTGTAAAC R:CGCAGTTGTTCGTGGCTCTC	124	58	SYBR

Molecular Types

mRNA

Evaluation Methods

geNorm method && Related Reference

Contact

Name: Nicoletta Vesentini
Email: nvesenti@ifc.cnr.it
Institution: Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

References

↑ ^1.0 ^1.1 ^1.2 Gubern C, Hurtado O, Rodríguez R, et al. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia[J]. BMC molecular biology, 2009, 10(1): 57.
↑ ^2.0 ^2.1 ^2.2 Langnaese K, John R, Schweizer H, et al. Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model[J]. BMC molecular biology, 2008, 9(1): 53.
↑ ^3.0 ^3.1 Tan S C, Carr C A, Yeoh K K, et al. Identification of valid housekeeping genes for quantitative RT-PCR analysis of cardiosphere-derived cells preconditioned under hypoxia or with prolyl-4-hydroxylase inhibitors[J]. Molecular biology reports, 2012, 39(4): 4857-4867.
↑ ^4.0 ^4.1 Zhang W X, Fan J, Ma J, et al. Selection of suitable reference genes for quantitative real-time PCR normalization in three types of rat adipose tissue[J]. International Journal of Molecular Sciences, 2016, 17(6): 968.
↑ ^5.0 ^5.1 ^5.2 Sirakov M, Borra M, Cambuli F M, et al. Defining suitable reference genes for RT-qPCR analysis on intestinal epithelial cells[J]. Molecular biotechnology, 2013, 54(3): 930-938.
↑ ^6.0 ^6.1 Zhang L, Liu S, Zhang L, et al. Real-time qPCR identifies suitable reference genes for Borna disease virus-infected rat cortical neurons[J]. International journal of molecular sciences, 2014, 15(12): 21825-21839.
↑ ^7.0 ^7.1 Sun J, Nan L, Gao C, et al. Validation of reference genes for estimating wound age in contused rat skeletal muscle by quantitative real-time PCR[J]. International journal of legal medicine, 2012, 126(1): 113-120.
↑ ^8.0 ^8.1 ^8.2 Vesentini N, Barsanti C, Martino A, et al. Selection of reference genes in different myocardial regions of an in vivo ischemia/reperfusion rat model for normalization of antioxidant gene expression[J]. BMC research notes, 2012, 5(1): 124.

@@ Line 1: / Line 1: @@
-=='''In-vivo and In-vitro Models of Eerebral Ischaemia'''==
+=='''Description'''==
+[[File:Rattus norvegicus.png|right|200px|link=Rattus norvegicus]]
+* '''''Rattus norvegicus''''' is one of the best known and most common rats. Thought to have originated in northern China, this rodent has now spread to all continents except Antarctica, and is the dominant rat in Europe and much of North America—making it by at least this particular definition the most successful mammal on the planet alongside humans [https://en.wikipedia.org/wiki/Brown_rat (Modified from Wikipedia)].
+* <font color=blue>'''Common Name:'''</font> '''Rat''', '''Brown rat'''
+* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10116 <font color=blue>'''NCBI Taxonomy'''</font>]
-===Reference Genes===
+=='''''Eerebral Ischaemia Model'''''==
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
@@ Line 8: / Line 14: @@
 ! style="width:35%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 16: / Line 22: @@
 |align="center"| Ribosomal Protein L13A
 |style="width:55%　font-size:9pt　"|
-* in-vitro model of cerebral ischaemia
+* In-vitro model of cerebral ischaemia
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_173340 '''NM_173340''']
 |nowrap style="font-size:9pt"|
@@ Line 28: / Line 34: @@
 |align="center"| Succinate dehydrogenase complex, subunit A
 |
-* in-vivo and in-vitro models of cerebral ischaemia
+* In-vivo and in-vitro models of cerebral ischaemia
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_130428.1 '''NM_130428.1''']
 |nowrap style="font-size:9pt"|
@@ Line 40: / Line 46: @@
 |align="center"| Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
 |
-* in-vivo model  of cerebral ischaemia
+* In-vivo model  of cerebral ischaemia
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013011.3 '''NM_013011.3''']
 |nowrap style="font-size:9pt"|
@@ Line 50: / Line 56: @@
 |}
-===Moleculer Types===
+===Molecular Types===
 * mRNA
@@ Line 60: / Line 66: @@
 *'''Name''': Judith Mallolas
 *'''Email''': jmallolas.girona.ics@gencat.cat
-*'''Institute''': Servei de Neurologia, Fundació Privada Institut d'Investigació Biomèdica de Girona Dr. Josep Trueta (IdIBGi), Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain
+*'''Institution''': Servei de Neurologia, Fundació Privada Institut d'Investigació Biomèdica de Girona Dr. Josep Trueta (IdIBGi), Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain
 ===Citation Statistics===
-Cited by '''79''' (Based on Google Scholar [2017-06-16])
+Cited by [https://scholar.google.com/scholar?cites=5013758709212631597&as_sdt=2005&sciodt=0,5&hl=en '''82'''] (Based on Google Scholar [2017-09-01])
-=='''Rat Asphyxial Cardiac Arrest Model'''==
+=='''''Asphyxial Cardiac Arrest Model'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
@@ Line 72: / Line 79: @@
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 78: / Line 85: @@
 |-
 |align="center"| CypA<ref name="ref2"/>
-|align="center"| cyclophilin A
+|align="center"| Cyclophilin A
 |
 * 4 and 21 days post injury
 * 7 days post treatment
+* Treated with the anti-inflammatory and anti-apoptotic drug minocycline
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/M19533 '''M19533 ''']
 |nowrap style="font-size:9pt"|
@@ Line 91: / Line 99: @@
 |-
 |align="center"| Pgk1<ref name="ref2"/>
-|align="center"| phosphoglycerate kinase 1
+|align="center"| Phosphoglycerate kinase 1
 |
 * 4 and 21 days post injury
+* Treated with the anti-inflammatory and anti-apoptotic drug minocycline
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_053291 '''NM_053291''']
 |nowrap style="font-size:9pt"|
@@ Line 103: / Line 112: @@
 |-
 |align="center"| Gapdh<ref name="ref2"/>
-|align="center"| glyceraldehyde-3-phosphate dehydrogenase
+|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 |
 * 7 days post injury
+* Treated with the anti-inflammatory and anti-apoptotic drug minocycline
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008 '''NM_017008''']
 |nowrap style="font-size:9pt"|
@@ Line 114: / Line 124: @@
 |align="center"| SYBR
 |}
-===Moleculer Types===
+===Molecular Types===
 * mRNA
@@ Line 124: / Line 135: @@
 *'''Name''': Kristina Langnaese
 *'''Email''': kristina.langnaese@med.ovgu.de
-*'''Institute''': nstitute of Medical Neurobiology, University of Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany
+*'''Institution''': nstitute of Medical Neurobiology, University of Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany
 ===Citation Statistics===
-Cited by '''81''' (Based on Google Scholar [2017-06-16])
+Cited by [https://scholar.google.com/scholar?cites=9456573743372315036&as_sdt=2005&sciodt=0,5&hl=en '''84'''] (Based on Google Scholar [2017-09-01])
-=='''Cardiosphere-derived Cells'''==
+=='''''Cardiosphere-derived Cells'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
@@ Line 136: / Line 148: @@
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 142: / Line 154: @@
 |-
 |align="center"| GAPDH<ref name="ref3"/>
-|align="center"| glyceraldehyde-3-phosphate dehy-drogenase
+|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 |
-* neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
+* Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008 '''NM_017008''']
 |nowrap style="font-size:9pt"|
 * F:GGGTGTGAACCACGAGAAAT
-* R:
+* R:ACTGTGGTCATGAGCCCTTC
 |align="center"| NA
 |align="center"| 60
 |align="center"| SYBR
 |-
-|align="center"| Actb<ref name="ref3"/>
+|align="center"| ACTB<ref name="ref3"/>
-|align="center"| Beta-actin
+|align="center"| β-actin
 |
-* neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
+* Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144 '''NM_031144''']
 |nowrap style="font-size:9pt"|
@@ Line 165: / Line 177: @@
 |align="center"| SYBR
 |}
-===Moleculer Types===
+===Molecular Types===
 * mRNA
@@ Line 175: / Line 188: @@
 *'''Name''': Carolyn A. Carr
 *'''Email''': carolyn.carr@dpag.ox.ac.uk
-*'''Institute''': Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, Sherrington Building, Parks Road, Oxford OX1 3PT, UK
+*'''Institution''': Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, Sherrington Building, Parks Road, Oxford OX1 3PT, UK
 ===Citation Statistics===
-Cited by '''50''' (Based on Google Scholar [2017-06-16])
+Cited by [https://scholar.google.com/scholar?cites=15278623732676908853&as_sdt=2005&sciodt=0,5&hl=en '''54'''] (Based on Google Scholar [2017-08-10])
-=='''Rat Adipose Tissue'''==
+=='''''Adipose Tissue'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
@@ Line 187: / Line 201: @@
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 195: / Line 209: @@
 |align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 |
-* eWAT Types of Rat Adipose Tissue
+* eWAT types of rat adipose tissue
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008.4 '''NM_017008.4''']
 |nowrap style="font-size:9pt"|
@@ Line 204: / Line 218: @@
 |align="center"| SYBR
 |-
-|align="center"| β-actin<ref name="ref4"/>
+|align="center"| ACTB<ref name="ref4"/>
 |align="center"| β-actin
 |
-*  iBeAT &  BAT Types of Rat Adipose Tissue
+*  iBeAT &  BAT types of rat adipose tissue
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144.3 '''NM_031144.3''']
 |nowrap style="font-size:9pt"|
@@ Line 216: / Line 230: @@
 |align="center"| SYBR
 |}
-===Moleculer Types===
+===Molecular Types===
 * mRNA
@@ Line 227: / Line 242: @@
 *'''Name''': You-E Yan
 *'''Email''': yanyoue@whu.edu.cn
-*'''Institute''': Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China
+*'''Institution''': Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China
 ===Citation Statistics===
-Cited by '''6''' (Based on Google Scholar [2017-06-16])
+Cited by [https://scholar.google.com/scholar?cites=5705193182835038858&as_sdt=2005&sciodt=0,5&hl=en '''8'''] (Based on Google Scholar [2017-09-01])
-=='''Intestinal Epithelial Cells'''==
+=='''''Intestinal Epithelial Cells'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 247: / Line 262: @@
 |align="center"| Peptidylprolyl isomerase B
 |
-Univeral reference gene in the differentiated fraction
+*Univeral reference gene in the differentiated fraction
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_022536.1 '''NM_022536.1''']
 |nowrap style="font-size:9pt"|
@@ Line 259: / Line 274: @@
 |align="center"| Peptidyl-prolyl cis–trans isomerase A
 |
-proliferating intestinal compartments and IEC6 cells.
+*Proliferating intestinal compartments and IEC6 cells.
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017101.1 '''NM_017101.1''']
 |nowrap style="font-size:9pt"|
@@ Line 271: / Line 286: @@
 |align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 |
-Univeral reference gene in the differentiated fraction
+*Univeral reference gene in the differentiated fraction
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008.4 '''NM_017008.4''']
 |nowrap style="font-size:9pt"|
@@ Line 281: / Line 296: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 291: / Line 306: @@
 *'''Name''': Maria Sirakov
 *'''Email''': maria.sirakov@ulb.ac.be
-*'''Institute''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium
+*'''Institution''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=6555526528695445385&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01])
-=='''Borna Disease Virus-Infected Rat Cortical Neurons'''==
+=='''''Borna Disease Viral Infection'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 310: / Line 327: @@
 |align="center"| Acidic ribosomal phosphoprotein P0
 |
-* Day-9-Borna Disease Virus-Infected Rat Cortical Neurons
+* Day-9-borna disease virus-infected rat cortical neurons
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_022402 '''NM_022402''']
 |nowrap style="font-size:9pt"|
@@ Line 320: / Line 337: @@
 |-
 |align="center"| ACTB<ref name="ref6"/>
-|align="center"| Beta-actin
+|align="center"| β-actin
 |
-* Day-12-Borna Disease Virus-Infected Rat Cortical Neurons
+* Day-12-borna disease virus-infected rat cortical neurons
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144 '''NM_031144''']
 |nowrap style="font-size:9pt"|
@@ Line 331: / Line 348: @@
 |align="center"| SYBR
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 343: / Line 361: @@
 *'''Name''': Peng Xie
 *'''Email''': xiepeng@cqmu.edu.cn
-*'''Institute''': Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China
+*'''Institution''': Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=5958914567126320806&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
-=='''Contused Rat Skeletal Muscle'''==
+=='''''Skeletal Muscle'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 360: / Line 380: @@
 |-
 |align="center"| RPL13<ref name="ref7"/>
-|align="center"| ribosomal protein L13
+|align="center"| Ribosomal protein L13
 |
-skeletal muscle
+* Contused rat skeletal muscle
+* Fall 150 cm through a clear Lucite guide tube onto the right posterior limb
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_173340 '''NM_173340 ''']
 |nowrap style="font-size:9pt"|
@@ Line 372: / Line 393: @@
 |-
 |align="center"| RPL32<ref name="ref7"/>
-|align="center"| ribosomal protein L32
+|align="center"| Ribosomal protein L32
 |
-skeletal muscle
+* Contused rat skeletal muscle
+* Fall 150 cm through a clear Lucite guide tube onto the right posterior limb
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013226 '''NM_013226''']
 |nowrap style="font-size:9pt"|
@@ Line 384: / Line 406: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 395: / Line 417: @@
 *'''Name''': Ying-yuan Wang
 *'''Email''': wyy580218@163.com
-*'''Institute''': Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China
+*'''Institution''': Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=16823738584799176214&as_sdt=2005&sciodt=0,5&hl=en '''35'''] (Based on Google Scholar [2017-09-01])
-=='''In Vivo Ischemia/reperfusion Rat Model'''==
+=='''''Ischemia & Reperfusion Model'''''==
-===Reference Genes===
+===Internal Control Genes===
 {|class="wikitable sortable" style="font-size:10pt; width:100%"
 |-
-! Gene symbol
+! Gene Symbol
-! Gene name
+! Gene Name
 ! style="width=25%　font-size:9pt　"|Application Scope
 ! Accession Number
-! Primer
+! Primers (5'-3')<br>[Forward/Reverse]
 ! Size [bp]
 ! Tm [℃]
@@ Line 413: / Line 437: @@
 |align="center"| Hydroxymethylbilane synthase
 |
-* right ventricle and  Remote region
+* Right ventricle and  Remote region
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013168 '''NM_013168''']
 |nowrap style="font-size:9pt"|
@@ Line 425: / Line 449: @@
 |align="center"| Phosphoribosyltransferase 1
 |
-* right ventricle and  Remote region
+* Right ventricle and  Remote region
-|align="center"|  https://www.ncbi.nlm.nih.gov/nuccore/NM_012583 '''NM_012583''']
+|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_012583 '''NM_012583''']
 |nowrap style="font-size:9pt"|
 * F:CCCAGCGTCGTGATTAGTGATG
@@ Line 437: / Line 461: @@
 |align="center"| TATA binding box protein
 |
-* right ventricle and  Remote region
+* Right ventricle and  Remote region
 |align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_001004198 '''NM_001004198''']
 |nowrap style="font-size:9pt"|
@@ Line 447: / Line 471: @@
 |}
-===Moleculer types===
+===Molecular Types===
 * mRNA
@@ Line 456: / Line 480: @@
 *'''Name''': Nicoletta Vesentini
 *'''Email''': nvesenti@ifc.cnr.it
-*'''Institute''': Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article
+*'''Institution''': Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article
+===Citation Statistics===
+Cited by [https://scholar.google.com/scholar?cites=18111341012430965555&as_sdt=2005&sciodt=0,5&hl=en '''15'''] (Based on Google Scholar [2017-09-01])
 =='''References'''==
@@ Line 493: / Line 519: @@
 </ref>
 </references>
+=='''Categories'''==
+[[Category:Animals]]
+[[Category:mRNA]]
+[[Category:SYBR]]
+[[Category:TaqMan]]
+[[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:ARBP]] [[Category:Cyclophilin]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:HMBS]] [[Category:HPRT]] [[Category:PGK]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:SDHA]] [[Category:TBP]] [[Category:YWHAZ]]
+[[Category:Specific Tissue]]  [[Category:Animal Model]]  [[Category:Viral Infection]]  [[Category:Cortical Neurons]]  [[Category:Specific Cells]]  [[Category:Skeletal Muscle]]  [[Category:Biotic Stress]]  [[Category:Pathological conditions]]
+{{Template:BackToTop}}
+[[Category:geNorm]]
+[[Category:NormFinder]]
+[[Category:BestKeeper]]
+[[Category:Delta Ct]]
+[[Category:RefFinder]]

Difference between revisions of "Rattus norvegicus"

Latest revision as of 14:20, 7 September 2017

Contents

Description

Eerebral Ischaemia Model

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Asphyxial Cardiac Arrest Model

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Cardiosphere-derived Cells

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Adipose Tissue

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Intestinal Epithelial Cells

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Borna Disease Viral Infection

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Skeletal Muscle

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

Ischemia & Reperfusion Model

Internal Control Genes

Molecular Types

Evaluation Methods

Contact

Citation Statistics

References

Categories

Navigation menu

Search