Difference between revisions of "Rattus norvegicus"

From ICG
Jump to navigation Jump to search
 
(65 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 +
=='''Description'''==
 +
[[File:Rattus norvegicus.png|right|200px|link=Rattus norvegicus]]
 +
* '''''Rattus norvegicus''''' is one of the best known and most common rats. Thought to have originated in northern China, this rodent has now spread to all continents except Antarctica, and is the dominant rat in Europe and much of North America—making it by at least this particular definition the most successful mammal on the planet alongside humans [https://en.wikipedia.org/wiki/Brown_rat (Modified from Wikipedia)].
 +
* <font color=blue>'''Common Name:'''</font> '''Rat''', '''Brown rat'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10116 <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
=='''''Eerebral Ischaemia Model'''''==
 
=='''''Eerebral Ischaemia Model'''''==
  
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 8: Line 14:
 
! style="width:35% font-size:9pt "|Application Scope  
 
! style="width:35% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 50: Line 56:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 60: Line 66:
 
*'''Name''': Judith Mallolas
 
*'''Name''': Judith Mallolas
 
*'''Email''': jmallolas.girona.ics@gencat.cat
 
*'''Email''': jmallolas.girona.ics@gencat.cat
*'''Institute''': Servei de Neurologia, Fundació Privada Institut d'Investigació Biomèdica de Girona Dr. Josep Trueta (IdIBGi), Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain
+
*'''Institution''': Servei de Neurologia, Fundació Privada Institut d'Investigació Biomèdica de Girona Dr. Josep Trueta (IdIBGi), Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''79''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=5013758709212631597&as_sdt=2005&sciodt=0,5&hl=en '''82'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Asphyxial Cardiac Arrest Model'''''==
 
=='''''Asphyxial Cardiac Arrest Model'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 72: Line 79:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 78: Line 85:
 
|-
 
|-
 
|align="center"| CypA<ref name="ref2"/>
 
|align="center"| CypA<ref name="ref2"/>
|align="center"| cyclophilin A
+
|align="center"| Cyclophilin A
 
|
 
|
 
* 4 and 21 days post injury
 
* 4 and 21 days post injury
 
* 7 days post treatment
 
* 7 days post treatment
 +
* Treated with the anti-inflammatory and anti-apoptotic drug minocycline
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/M19533 '''M19533 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/M19533 '''M19533 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 91: Line 99:
 
|-
 
|-
 
|align="center"| Pgk1<ref name="ref2"/>
 
|align="center"| Pgk1<ref name="ref2"/>
|align="center"| phosphoglycerate kinase 1
+
|align="center"| Phosphoglycerate kinase 1
 
|
 
|
 
* 4 and 21 days post injury
 
* 4 and 21 days post injury
 +
* Treated with the anti-inflammatory and anti-apoptotic drug minocycline
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_053291 '''NM_053291''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_053291 '''NM_053291''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 103: Line 112:
 
|-
 
|-
 
|align="center"| Gapdh<ref name="ref2"/>
 
|align="center"| Gapdh<ref name="ref2"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
 
* 7 days post injury
 
* 7 days post injury
 +
* Treated with the anti-inflammatory and anti-apoptotic drug minocycline
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008 '''NM_017008''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008 '''NM_017008''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 114: Line 124:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer Types===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 124: Line 135:
 
*'''Name''': Kristina Langnaese
 
*'''Name''': Kristina Langnaese
 
*'''Email''': kristina.langnaese@med.ovgu.de
 
*'''Email''': kristina.langnaese@med.ovgu.de
*'''Institute''': nstitute of Medical Neurobiology, University of Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany
+
*'''Institution''': nstitute of Medical Neurobiology, University of Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''81''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=9456573743372315036&as_sdt=2005&sciodt=0,5&hl=en '''84'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Cardiosphere-derived Cells'''''==
 
=='''''Cardiosphere-derived Cells'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 136: Line 148:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 142: Line 154:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref3"/>
 
|align="center"| GAPDH<ref name="ref3"/>
|align="center"| glyceraldehyde-3-phosphate dehy-drogenase
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
 
* Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
 
* Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
Line 148: Line 160:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GGGTGTGAACCACGAGAAAT
 
* F:GGGTGTGAACCACGAGAAAT
* R:
+
* R:ACTGTGGTCATGAGCCCTTC
 
|align="center"| NA
 
|align="center"| NA
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
|align="center"| Actb<ref name="ref3"/>
+
|align="center"| ACTB<ref name="ref3"/>
|align="center"| Beta-actin
+
|align="center"| β-actin
 
|
 
|
 
* Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
 
* Neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs
Line 165: Line 177:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer Types===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 175: Line 188:
 
*'''Name''': Carolyn A. Carr
 
*'''Name''': Carolyn A. Carr
 
*'''Email''': carolyn.carr@dpag.ox.ac.uk
 
*'''Email''': carolyn.carr@dpag.ox.ac.uk
*'''Institute''': Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, Sherrington Building, Parks Road, Oxford OX1 3PT, UK
+
*'''Institution''': Cardiac Metabolism Research Group, Department of Physiology, Anatomy & Genetics, University of Oxford, Sherrington Building, Parks Road, Oxford OX1 3PT, UK
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''50''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=15278623732676908853&as_sdt=2005&sciodt=0,5&hl=en '''54'''] (Based on Google Scholar [2017-08-10])
  
 
=='''''Adipose Tissue'''''==
 
=='''''Adipose Tissue'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 187: Line 201:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 195: Line 209:
 
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
* eWAT Types of Rat Adipose Tissue
+
* eWAT types of rat adipose tissue
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008.4 '''NM_017008.4''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_017008.4 '''NM_017008.4''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 204: Line 218:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
|align="center"| β-actin<ref name="ref4"/>
+
|align="center"| ACTB<ref name="ref4"/>
 
|align="center"| β-actin
 
|align="center"| β-actin
 
|
 
|
*  iBeAT &  BAT Types of Rat Adipose Tissue
+
*  iBeAT &  BAT types of rat adipose tissue
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144.3 '''NM_031144.3''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144.3 '''NM_031144.3''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 216: Line 230:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer Types===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 227: Line 242:
 
*'''Name''': You-E Yan
 
*'''Name''': You-E Yan
 
*'''Email''': yanyoue@whu.edu.cn
 
*'''Email''': yanyoue@whu.edu.cn
*'''Institute''': Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China
+
*'''Institution''': Department of Pharmacology, Basic Medical School of Wuhan University, 185, DongHu Road, Wuhan 430071, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''6''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=5705193182835038858&as_sdt=2005&sciodt=0,5&hl=en '''8'''] (Based on Google Scholar [2017-09-01])
  
=='''Intestinal Epithelial Cells'''==
+
=='''''Intestinal Epithelial Cells'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 239: Line 254:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 281: Line 296:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 291: Line 306:
 
*'''Name''': Maria Sirakov
 
*'''Name''': Maria Sirakov
 
*'''Email''': maria.sirakov@ulb.ac.be
 
*'''Email''': maria.sirakov@ulb.ac.be
*'''Institute''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium
+
*'''Institution''': Laboratoire de Génétique du Développement, Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires (IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies,Belgium
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''4''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=6555526528695445385&as_sdt=2005&sciodt=0,5&hl=en '''5'''] (Based on Google Scholar [2017-09-01])
  
=='''Borna Disease Virus-Infected Rat Cortical Neurons'''==
+
=='''''Borna Disease Viral Infection'''''==
  
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 304: Line 319:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 312: Line 327:
 
|align="center"| Acidic ribosomal phosphoprotein P0
 
|align="center"| Acidic ribosomal phosphoprotein P0
 
|
 
|
* Day-9-Borna Disease Virus-Infected Rat Cortical Neurons
+
* Day-9-borna disease virus-infected rat cortical neurons
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_022402 '''NM_022402''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_022402 '''NM_022402''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 322: Line 337:
 
|-
 
|-
 
|align="center"| ACTB<ref name="ref6"/>
 
|align="center"| ACTB<ref name="ref6"/>
|align="center"| Beta-actin
+
|align="center"| β-actin
 
|
 
|
* Day-12-Borna Disease Virus-Infected Rat Cortical Neurons
+
* Day-12-borna disease virus-infected rat cortical neurons
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144 '''NM_031144''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_031144 '''NM_031144''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 333: Line 348:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer Types===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 345: Line 361:
 
*'''Name''': Peng Xie
 
*'''Name''': Peng Xie
 
*'''Email''': xiepeng@cqmu.edu.cn
 
*'''Email''': xiepeng@cqmu.edu.cn
*'''Institute''': Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China
+
*'''Institution''': Department of Neurology, Yongchuan Hospital, Chongqing Medical University, Chongqing 402460, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''10''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=5958914567126320806&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
  
=='''Skeletal Muscle'''==
+
=='''''Skeletal Muscle'''''==
  
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 358: Line 374:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 364: Line 380:
 
|-
 
|-
 
|align="center"| RPL13<ref name="ref7"/>
 
|align="center"| RPL13<ref name="ref7"/>
|align="center"| ribosomal protein L13
+
|align="center"| Ribosomal protein L13
 
|
 
|
*Contused rat skeletal muscle
+
* Contused rat skeletal muscle
 +
* Fall 150 cm through a clear Lucite guide tube onto the right posterior limb
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_173340 '''NM_173340 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_173340 '''NM_173340 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 376: Line 393:
 
|-
 
|-
 
|align="center"| RPL32<ref name="ref7"/>
 
|align="center"| RPL32<ref name="ref7"/>
|align="center"| ribosomal protein L32
+
|align="center"| Ribosomal protein L32
 
|
 
|
*Contused rat skeletal muscle
+
* Contused rat skeletal muscle
 +
* Fall 150 cm through a clear Lucite guide tube onto the right posterior limb
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013226 '''NM_013226''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/NM_013226 '''NM_013226''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 388: Line 406:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 399: Line 417:
 
*'''Name''': Ying-yuan Wang
 
*'''Name''': Ying-yuan Wang
 
*'''Email''': wyy580218@163.com
 
*'''Email''': wyy580218@163.com
*'''Institute''': Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China
+
*'''Institution''': Department of Forensic Pathology, Shanxi Medical University, 56 South Xinjian Road, Taiyuan 030001, Shanxi, People’s Republic of China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''34''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16823738584799176214&as_sdt=2005&sciodt=0,5&hl=en '''35'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Ischemia & Reperfusion Model'''''==
 
=='''''Ischemia & Reperfusion Model'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 411: Line 429:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 453: Line 471:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 462: Line 480:
 
*'''Name''': Nicoletta Vesentini
 
*'''Name''': Nicoletta Vesentini
 
*'''Email''': nvesenti@ifc.cnr.it
 
*'''Email''': nvesenti@ifc.cnr.it
*'''Institute''': Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article
+
*'''Institution''': Istituto di Fisiologia Clinica, Consiglio Nazionale delle Ricerche, Pisa, Italy Full list of author information is available at the end of the article
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''14''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=18111341012430965555&as_sdt=2005&sciodt=0,5&hl=en '''15'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 501: Line 519:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:TaqMan]]
 
[[Category:TaqMan]]
[[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:ARBP]] [[Category:CYC]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:HMBS]] [[Category:HPRT]] [[Category:PGK]] [[Category:PPI]] [[Category:PPI]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:SDHA]] [[Category:TBP]] [[Category:YWHAZ]]
+
[[Category:ACT]] [[Category:ACT]] [[Category:ACT]] [[Category:ARBP]] [[Category:Cyclophilin]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:GAPDH]] [[Category:HMBS]] [[Category:HPRT]] [[Category:PGK]] [[Category:RPL]] [[Category:RPL]] [[Category:RPL]] [[Category:SDHA]] [[Category:TBP]] [[Category:YWHAZ]]
 +
[[Category:Specific Tissue]]  [[Category:Animal Model]]  [[Category:Viral Infection]]  [[Category:Cortical Neurons]]  [[Category:Specific Cells]]  [[Category:Skeletal Muscle]]  [[Category:Biotic Stress]]  [[Category:Pathological conditions]]
 +
{{Template:BackToTop}}
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 14:20, 7 September 2017