Rhodnius prolixus

From ICG
Revision as of 11:07, 21 June 2017 by ICG Expert4 (talk | contribs)
Jump to navigation Jump to search

Description

Rhodnius prolixus.jpg
  • Rhodnius prolixus is the second most important triatomine vector of the Chagas parasite due to both its sylvatic and domestic populations in northern South America as well as to its exclusively domestic populations in Central America.
  • It has a wide range of ecotopes, mainly savanna and foothills with an altitude of between 500 meters to 1,500 meters (1600 feet to 4,900 feet) above sea level and temperatures of 16 °C to 28 °C (61 °F to 82 °F). Sylvatic R. prolixus, as virtually all Rhodnius spp., is primarily associated with palm tree habitats and has a wide range of hosts including birds, rodents, marsupials, sloths, and reptiles.
  • hodnius prolixus is a major vector of Chagas disease, an illness caused by Trypanosoma cruzi which affects approximately 7 million people worldwide[1][2].

Different Experimental Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18S[1] 18S ribosomal RNA
  • In the salivary gland and the intestine
AJ421962
  • F:TCCTTCGTGCTAGGAATTGG
  • R:GTACAAAGGGCAGGGACGTA
105 60 SYBR
GAPDH[1] Glyceralde hyde-3- phosphate dehydrogen ase
  • In the salivary gland and the intestine
ACPB02038754
  • F:GTACAAAGGGCAGGGACGTA
  • R:AGCTGACGGGGCTGTTATTA
111 60 SYBR
TUB[1] α-tubulin
  • In the salivary gland and the intestine
ACPB02030650
  • F:TTTCCTCGATCACTGCTTCC
  • R:CGGAAATAACTGGGGCATAA
129 60 SYBR
ACT[1] β-actin
  • Salivary glands
EU233794
  • F:AATCAAGATCATTGCTCCACCAG
  • R:TTAGAAGCATTTGCGGTGGAC
151 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: N Araújo
  • Email: rnaraujo@icb.ufmg.br
  • Institution: Departamento de Parasitologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais. Bloco I4, Sala 177, Av. Antonio Carlos 6627, Pampulha, CEP 30270-901 Belo Horizonte, MG, Brazil

Citation Statistics

Cited by 47 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 Paim R M, Pereira M H, Di Ponzio R, et al. Validation of reference genes for expression analysis in the salivary gland and the intestine of Rhodnius prolixus (Hemiptera, Reduviidae) under different experimental conditions by quantitative real-time PCR[J]. BMC Research Notes, 2012, 5(1): 128.
  2. Mesquita R D, Vionette-Amaral R J, Lowenberger C, et al. Genome of Rhodnius prolixus, an insect vector of Chagas disease, reveals unique adaptations to hematophagy and parasite infection[J]. Proceedings of the National Academy of Sciences, 2015, 112(48): 14936-14941.