Difference between revisions of "Rhododendron simsii"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
==Description==
+
=='''Description'''==
  
 
[[File:Rhododendron simsii-1.jpg|right|327px|]]
 
[[File:Rhododendron simsii-1.jpg|right|327px|]]

Revision as of 04:54, 26 June 2017

Description

Rhododendron simsii-1.jpg
  • Plants belonging to the Rhododendron subgenera Pentanthera (deciduous) and Tsutsusi and Azaleastrum (evergreen) are called azaleas.
  • Azalea is an important ornamentals with a long breeding tradition, it is a rare species in this genus flowering during summer, which provides a unique resource for floral timing breeding[1] [2].
  • Common Name: Red Azalea
  • NCBI Taxonomy

Flower Colour

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
HK5[1] Histone H3
  • Universal reference gene
AM932886
  • F:GAAACTCCCATTCCAGAGGCT
  • R:GCATGGATGGCACAGAGGTT
153 60 SYBR
HK173[1] Pyruvate dehydrogenase
  • Universal reference gene
FN552704
  • F:GGTGCGAGATTGGTATTTGGA
  • R:TTGAACTCCCAAAGCCATTGT
151 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ellen De Keyser
  • Email: Ellen.dekeyser@ilvo.vlaanderen.be
  • Institution: Institute for Agricultural and Fisheries Research (ILVO)-Plant Sciences Unit, Caritasstraat 21, 9090, Melle, Belgium

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 De Keyser E, Desmet L, Van Bockstaele E, et al. How to perform RT-qPCR accurately in plant species? A case study on flower colour gene expression in an azalea (Rhododendron simsii hybrids) mapping population[J]. BMC molecular biology, 2013, 14(1): 13.
  2. Zhengqi Fan, Jiyuan Li, Xinlei Li, Bin Wu, Jiangying Wang, Zhongchi Liu & Hengfu Yin. Genome-wide transcriptome profiling provides insights into floral bud development of summer-flowering Camellia azalea. Sci Rep. 2015 May 15;5:9729. doi: 10.1038/srep09729.PMID: 25978548.