Difference between revisions of "Rosa hybrida"

From ICG
Jump to navigation Jump to search
 
(16 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File: Rosa hybrida.png|right|200px|link=Rosa hybrida]]
 +
* '''''Rosa hybrida''''' is one of the economically most important ornamentals worldwide. They are produced as cut and potted plants and garden and landscaping plants, due to their attractive appearance, with a production value of 24 billion Euros from 1995 to 2007. Apart from the beauty of their flowers, roses are also admired for their delicate scent. Their scent is composed of a number of metabolites, which are partly derived from genes unique to roses. Other characteristics important for rose breeding and cultivation are tolerance or resistance to abiotic stress and diseases such as black spot, powdery mildew and downy mildew<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Miniature rose'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=128735 <font color=blue>'''NCBI Taxonomy'''</font>]
  
[[File: Rosa hybrida-1.jpg|right|327px|]]
+
=='''''Different Genotypes & Tissues & Abiotic Stress'''''==
* Roses are one of the economically most important ornaentals worldwide. They are produced as cut and potted plants and garden and landscaping plants with a production value of 24 billion Euros from 1995 to 2007. Other, less prominent uses include medicinal applications or the consumption in teas and soups. Apart from the beauty of their flowers, roses are also admired for their delicate scent. Their scent is composed of a number of metabolites, which are partly derived fromgenes unique to roses . Other characteristics important for rose breeding and cultivation are tolerance or resistance to abiotic stress (e.g., cold and heat) and diseases such as black spot, powdery mildew and downy mildew .
+
===Internal Control Genes===
* A number of ornamental plants, including rose (Rosa hybrida), peony (Paeonia suffruticosa), carnation (Dianthus caryophyllus), and camellia (Camellia japonica), have flowers with greater numbers of petals (termed double flowers) and consequently are popular garden plants, due to their attractive appearance<ref name="ref1"/> <ref name="ref2"/>.
 
 
 
=='''''Various Stress Factors'''''==
 
===Reference Genes===
 
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 19: Line 19:
 
|-
 
|-
 
|align="center"|  PP2A<ref name="ref1"/>
 
|align="center"|  PP2A<ref name="ref1"/>
|align="center"| protein phosphatase 2A
+
|align="center"| Protein phosphatase 2A
 
|
 
|
 
*Different rose tissues from three different genotypes of Rosa hybrida and in leaves treated with various stress factors
 
*Different rose tissues from three different genotypes of Rosa hybrida and in leaves treated with various stress factors
Line 31: Line 31:
 
|-
 
|-
 
|align="center"|  UBC<ref name="ref1"/>
 
|align="center"|  UBC<ref name="ref1"/>
|align="center"| ubiquitin conjugating protein
+
|align="center"| Ubiquitin conjugating protein
 
|
 
|
 
*Different rose tissues from three different genotypes of Rosa hybrida and in leaves treated with various stress factors
 
*Different rose tissues from three different genotypes of Rosa hybrida and in leaves treated with various stress factors
Line 43: Line 43:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 52: Line 53:
 
*'''Name''': Thomas Debener
 
*'''Name''': Thomas Debener
 
*'''Email''': debener@genetik.uni-hannover.de
 
*'''Email''': debener@genetik.uni-hannover.de
*'''Institution''': Department of Molecular Plant Breeding, Institute for Plant Genetics, Leibniz Universit?t Hannover, Herrenh?user Str. 2, 30419 Hannover, Germany
+
*'''Institution''': Department of Molecular Plant Breeding, Institute for Plant Genetics, Leibniz Universität Hannover, Herrenhäuser Str. 2, 30419 Hannover, Germany
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''52''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=14586791125998640436&as_sdt=2005&sciodt=0,5&hl=en'''57'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 62: Line 64:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Nan Ma,Wen Chen, Tiangang Fan, Yaran Tian, Shuai Zhang, Daxing Zeng, and Yonghong Li.Low temperature-induced DNA hypermethylation attenuates expression of RhAG, an AGAMOUS homolog, and increases petal number in rose (Rosa hybrida).BMC Plant Biol. 2015 Oct 5;15:237. doi: 10.1186/s12870-015-0623-1.PMID: 26438149 PMCID: PMC4595006  
+
Nan Ma,Wen Chen, Tiangang Fan, Yaran Tian, Shuai Zhang, Daxing Zeng, and Yonghong Li.Low temperature-induced DNA hypermethylation attenuates expression of RhAG, an AGAMOUS homolog, and increases petal number in rose (Rosa hybrida).BMC Plant Biol. 2015 Oct 5;15:237. doi: 10.1186/s12870-015-0623-1.PMID: 26438149 PMCID: PMC4595006.
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]]
 
[[Category:mRNA]]
 
  
[[Category:SYBR]]
+
=='''Categories'''==
[[Category:PP2A]] [[Category:Ubiquitin]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:PP2A]][[Category:Ubiquitin]][[Category:Different Genotypes]][[Category:Different Tissues]]  [[Category:Abiotic Stress]][[Category:Pathological conditions]][[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]]

Latest revision as of 07:27, 1 September 2017

Description

Rosa hybrida.png
  • Rosa hybrida is one of the economically most important ornamentals worldwide. They are produced as cut and potted plants and garden and landscaping plants, due to their attractive appearance, with a production value of 24 billion Euros from 1995 to 2007. Apart from the beauty of their flowers, roses are also admired for their delicate scent. Their scent is composed of a number of metabolites, which are partly derived from genes unique to roses. Other characteristics important for rose breeding and cultivation are tolerance or resistance to abiotic stress and diseases such as black spot, powdery mildew and downy mildew[1][2].
  • Common Name: Miniature rose
  • NCBI Taxonomy

Different Genotypes & Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PP2A[1] Protein phosphatase 2A
  • Different rose tissues from three different genotypes of Rosa hybrida and in leaves treated with various stress factors
JN399224
  • F:TGTCACTGCATCAAAGGACAG
  • R:GACGAATTGTCTTCTCCACCA
110 60 SYBR
UBC[1] Ubiquitin conjugating protein
  • Different rose tissues from three different genotypes of Rosa hybrida and in leaves treated with various stress factors
JN399227
  • F:GCCAGAGATTGCCCATATGTA
  • R:TCACAGAGTCCTAGCAGCACA
109 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Thomas Debener
  • Email: debener@genetik.uni-hannover.de
  • Institution: Department of Molecular Plant Breeding, Institute for Plant Genetics, Leibniz Universität Hannover, Herrenhäuser Str. 2, 30419 Hannover, Germany

Citation Statistics

Cited by 57 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Klie M, Debener T. Identification of superior reference genes for data normalisation of expression studies via quantitative PCR in hybrid roses (Rosa hybrida)[J]. BMC Research Notes, 2011, 4(1): 518.
  2. Nan Ma,Wen Chen, Tiangang Fan, Yaran Tian, Shuai Zhang, Daxing Zeng, and Yonghong Li.Low temperature-induced DNA hypermethylation attenuates expression of RhAG, an AGAMOUS homolog, and increases petal number in rose (Rosa hybrida).BMC Plant Biol. 2015 Oct 5;15:237. doi: 10.1186/s12870-015-0623-1.PMID: 26438149 PMCID: PMC4595006.

Categories