Rosa hybrida

From ICG
Jump to navigation Jump to search

Description

Rosa hybrida-1.jpg
  • Roses are one of the economically most important ornaentals worldwide. They are produced as cut and potted plants and garden and landscaping plants with a production value of 24 billion Euros from 1995 to 2007. Other, less prominent uses include medicinal applications or the consumption in teas and soups. Apart from the beauty of their flowers, roses are also admired for their delicate scent. Their scent is composed of a number of metabolites, which are partly derived fromgenes unique to roses . Other characteristics important for rose breeding and cultivation are tolerance or resistance to abiotic stress (e.g., cold and heat) and diseases such as black spot, powdery mildew and downy mildew .
  • A number of ornamental plants, including rose (Rosa hybrida), peony (Paeonia suffruticosa), carnation (Dianthus caryophyllus), and camellia (Camellia japonica), have flowers with greater numbers of petals (termed double flowers) and consequently are popular garden plants, due to their attractive appearance[1] [2].
  • Common Name: Miniature rose
  • NCBI Taxonomy

Different Genotypes & Tissues & Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PP2A[1] Protein phosphatase 2A
  • Different rose tissues from three different genotypes of Rosa hybrida and in leaves treated with various stress factors
JN399224
  • F:TGTCACTGCATCAAAGGACAG
  • R:GACGAATTGTCTTCTCCACCA
110 60 SYBR
UBC[1] Ubiquitin conjugating protein
  • Different rose tissues from three different genotypes of Rosa hybrida and in leaves treated with various stress factors
JN399227
  • F:GCCAGAGATTGCCCATATGTA
  • R:TCACAGAGTCCTAGCAGCACA
109 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Thomas Debener
  • Email: debener@genetik.uni-hannover.de
  • Institution: Department of Molecular Plant Breeding, Institute for Plant Genetics, Leibniz Universität Hannover, Herrenhäuser Str. 2, 30419 Hannover, Germany

Citation Statistics

Cited by 52 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Klie M, Debener T. Identification of superior reference genes for data normalisation of expression studies via quantitative PCR in hybrid roses (Rosa hybrida)[J]. BMC Research Notes, 2011, 4(1): 518.
  2. Nan Ma,Wen Chen, Tiangang Fan, Yaran Tian, Shuai Zhang, Daxing Zeng, and Yonghong Li.Low temperature-induced DNA hypermethylation attenuates expression of RhAG, an AGAMOUS homolog, and increases petal number in rose (Rosa hybrida).BMC Plant Biol. 2015 Oct 5;15:237. doi: 10.1186/s12870-015-0623-1.PMID: 26438149 PMCID: PMC4595006.