Rosa hybrida

From ICG
Revision as of 14:37, 16 June 2017 by Xysj2012 (talk | contribs) (Created page with "=='''Description'''== =='''''Various Stress Factors'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Nam...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Various Stress Factors

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PP2A[1] protein phosphatase 2A

different rose tissues from three different genotypes of Rosa hybrida and in leaves treated with various stress factors

JN399224
  • F:TGTCACTGCATCAAAGGACAG
  • R:GACGAATTGTCTTCTCCACCA
110 60 SYBR
UBC[1] ubiquitin conjugating protein

different rose tissues from three different genotypes of Rosa hybrida and in leaves treated with various stress factors

JN399227
  • F:GCCAGAGATTGCCCATATGTA
  • R:TCACAGAGTCCTAGCAGCACA
109 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Thomas Debener
  • Email: debener@genetik.uni-hannover.de
  • Institution: Department of Molecular Plant Breeding, Institute for Plant Genetics, Leibniz Universit?t Hannover, Herrenh?user Str. 2, 30419 Hannover, Germany

References

  1. 1.0 1.1 Klie M, Debener T. Identification of superior reference genes for data normalisation of expression studies via quantitative PCR in hybrid roses (Rosa hybrida)[J]. BMC Research Notes, 2011, 4(1): 518.