Difference between revisions of "Ruditapes philippinarum"

From ICG
Jump to navigation Jump to search
 
(18 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2016010-1.jpg|right|327px|]]
+
[[File:Ruditapes philippinarum.png|right|200px|link=Ruditapes philippinarum]]
* The clam fishery based on the species Ruditapes decussatus is one of the oldest mollusc fishery practices in Europe and was one of Europe's most important marine resources until the 1960's. For aquaculture purposes, the Manila clam Ruditapes philippinarum was then deliberately introduced as hatchery brood stock into France in 1972 and into the UK and Ireland in 1980 and 1982, respectively.
+
* '''''Ruditapes philippinarum''''', native to Japan, Korea, and the Philippines, was introduced accidentally, along with Pacific oysters, into North America during the 1930's. Currently, the Manila clam is distributed widely on Pacific coasts of Canada and the USA, Mediterranean and Atlantic coasts of Western Europe, Korean and Japanese waters, as well as on the East coast of China. For aquaculture purposes, it was then deliberately introduced as hatchery brood stock into France in 1972 and into the UK and Ireland in 1980 and 1982, respectively <ref name="ref1"/> <ref name="ref2"/>.
* The species Manila clam, native to Japan, Korea, and the Philippines, was introduced accidentally, along with Pacific oysters, into North America during the 1930's. Currently, the Manila clam is distributed widely on Pacific coasts of Canada and the USA, Mediterranean and Atlantic coasts of Western Europe, Korean and Japanese waters, as well as on the East coast of China. In contrast, R. decussatus can only be found on the Atlantic coasts of North Africa and Western Europe south of Scandinavian waters.
+
* <font color=blue>'''Common Name:'''</font> '''Manila clam'''
* We further critically discuss methods for reference gene validation based on a case study using copper exposed primary hemocytes from the marine bivalve Ruditapes philippinarum; including the established algorithms geNorm, NormFinder and BestKeeper, as well as the popular online tool RefFinder. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=129788 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Copper Treated'''''==
 
=='''''Copper Treated'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 19: Line 19:
 
|-
 
|-
 
|align="center"| EF1A<ref name="ref1"/>
 
|align="center"| EF1A<ref name="ref1"/>
|align="center"| elongation factor 1 alpha  
+
|align="center"| Elongation factor 1 alpha  
 
|
 
|
 
* Hemocyte under CuO stress
 
* Hemocyte under CuO stress
Line 25: Line 25:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AAATGCACCACGAGTCCCTC
 
* F:AAATGCACCACGAGTCCCTC
* R:AAATGCACCACGAGTCCCTC
+
* R:CTTGCAGCTCCCTTTGGTGG
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
Line 31: Line 31:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref1"/>
 
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
 
* Hemocyte under CuO stress
 
* Hemocyte under CuO stress
Line 37: Line 37:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CCAGAAGGTTGTGGATGGGC
 
* F:CCAGAAGGTTGTGGATGGGC
* R:CCAGAAGGTTGTGGATGGGC
+
* R:GCGGCACCAGTAGATGATGG
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
Line 43: Line 43:
 
|-
 
|-
 
|align="center"| TUBA<ref name="ref1"/>
 
|align="center"| TUBA<ref name="ref1"/>
|align="center"| tubulin alpha chain, mRNA sequence
+
|align="center"| Tubulin alpha chain
 
|
 
|
 
* Hemocyte under CuO stress
 
* Hemocyte under CuO stress
Line 49: Line 49:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AAGAGAGCCTTTGTCCACTGGT
 
* F:AAGAGAGCCTTTGTCCACTGGT
* R:AAGAGAGCCTTTGTCCACTGGT
+
* R:CCTCTCCCTCGCCTTCAACT
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
Line 61: Line 61:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CGTAGGAAAGTCGCTGGCTC
 
* F:CGTAGGAAAGTCGCTGGCTC
* R:CGTAGGAAAGTCGCTGGCTC
+
* R:ATAGGGGCCTCATCAGTGGG
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
Line 67: Line 67:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 79: Line 79:
 
*'''Institution''': Instituto de Ciencias Marinas de Andalucía (CSIC), Campus Universitario Río San Pedro s/n, 11510 Puerto Real, Cadiz, Spain
 
*'''Institution''': Instituto de Ciencias Marinas de Andalucía (CSIC), Campus Universitario Río San Pedro s/n, 11510 Puerto Real, Cadiz, Spain
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''0''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=13566450874189021784&as_sdt=2005&sciodt=0,5&hl=en '''1'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 91: Line 91:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
[[Category:mRNA]] 
+
[[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 +
[[Category:EF1α]] [[Category:GAPDH]] [[Category:RPS]] [[Category:Tubulin]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 04:36, 1 September 2017

Description

Ruditapes philippinarum.png
  • Ruditapes philippinarum, native to Japan, Korea, and the Philippines, was introduced accidentally, along with Pacific oysters, into North America during the 1930's. Currently, the Manila clam is distributed widely on Pacific coasts of Canada and the USA, Mediterranean and Atlantic coasts of Western Europe, Korean and Japanese waters, as well as on the East coast of China. For aquaculture purposes, it was then deliberately introduced as hatchery brood stock into France in 1972 and into the UK and Ireland in 1980 and 1982, respectively [1] [2].
  • Common Name: Manila clam
  • NCBI Taxonomy

Copper Treated

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1A[1] Elongation factor 1 alpha
  • Hemocyte under CuO stress
JK845897
  • F:AAATGCACCACGAGTCCCTC
  • R:CTTGCAGCTCCCTTTGGTGG
NA 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Hemocyte under CuO stress
ruditapes_c8255
  • F:CCAGAAGGTTGTGGATGGGC
  • R:GCGGCACCAGTAGATGATGG
NA 60 SYBR
TUBA[1] Tubulin alpha chain
  • Hemocyte under CuO stress
JK982951
  • F:AAGAGAGCCTTTGTCCACTGGT
  • R:CCTCTCCCTCGCCTTCAACT
NA 60 SYBR
RPS20[1] 40s Ribosomal Protein s20
  • Hemocyte under CuO stress
ruditapes_lrc33291
  • F:CGTAGGAAAGTCGCTGGCTC
  • R:ATAGGGGCCTCATCAGTGGG
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Moritz Volland
  • Email: moritz.volland@icman.csic.es
  • Institution: Instituto de Ciencias Marinas de Andalucía (CSIC), Campus Universitario Río San Pedro s/n, 11510 Puerto Real, Cadiz, Spain

Citation Statistics

Cited by 1 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Volland M, Blasco J, Hampel M (2017) Validation of reference genes for RT-qPCR in marine bivalve ecotoxicology: Systematic review and case study using copper treated primary Ruditapes philippinarum hemocytes. Aquat Toxicol 185, 86-94.
  2. Donaghy L, Lambert C, Choi KS, Soudant P (2009) Hemocytes of the carpet shell clam (Ruditapes decussatus) and the Manila clam (Ruditapes philippinarum): Current knowledge and future prospects. Aquaculture 297, 10-24.

Categories