Difference between revisions of "Ruditapes philippinarum"

From ICG
Jump to navigation Jump to search
Line 95: Line 95:
 
[[Category:mRNA]]   
 
[[Category:mRNA]]   
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 +
[[Category:EF1α]] [[Category:GAPDH]] [[Category:RPS]] [[Category:Tubulin]]

Revision as of 09:07, 19 June 2017

Description

REFqPCR2016010-1.jpg
  • The clam fishery based on the species Ruditapes decussatus is one of the oldest mollusc fishery practices in Europe and was one of Europe's most important marine resources until the 1960's. For aquaculture purposes, the Manila clam Ruditapes philippinarum was then deliberately introduced as hatchery brood stock into France in 1972 and into the UK and Ireland in 1980 and 1982, respectively.
  • The species Manila clam, native to Japan, Korea, and the Philippines, was introduced accidentally, along with Pacific oysters, into North America during the 1930's. Currently, the Manila clam is distributed widely on Pacific coasts of Canada and the USA, Mediterranean and Atlantic coasts of Western Europe, Korean and Japanese waters, as well as on the East coast of China. In contrast, R. decussatus can only be found on the Atlantic coasts of North Africa and Western Europe south of Scandinavian waters.
  • We further critically discuss methods for reference gene validation based on a case study using copper exposed primary hemocytes from the marine bivalve Ruditapes philippinarum; including the established algorithms geNorm, NormFinder and BestKeeper, as well as the popular online tool RefFinder. [1] [2].

Copper Treated

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF1A[1] elongation factor 1 alpha
  • Hemocyte under CuO stress
JK845897
  • F:AAATGCACCACGAGTCCCTC
  • R:AAATGCACCACGAGTCCCTC
NA 60 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity
  • Hemocyte under CuO stress
ruditapes_c8255
  • F:CCAGAAGGTTGTGGATGGGC
  • R:CCAGAAGGTTGTGGATGGGC
NA 60 SYBR
TUBA[1] tubulin alpha chain, mRNA sequence
  • Hemocyte under CuO stress
JK982951
  • F:AAGAGAGCCTTTGTCCACTGGT
  • R:AAGAGAGCCTTTGTCCACTGGT
NA 60 SYBR
RPS20[1] 40s Ribosomal Protein s20
  • Hemocyte under CuO stress
ruditapes_lrc33291
  • F:CGTAGGAAAGTCGCTGGCTC
  • R:CGTAGGAAAGTCGCTGGCTC
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Moritz Volland
  • Email: moritz.volland@icman.csic.es
  • Institution: Instituto de Ciencias Marinas de Andalucía (CSIC), Campus Universitario Río San Pedro s/n, 11510 Puerto Real, Cadiz, Spain

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Volland M, Blasco J, Hampel M (2017) Validation of reference genes for RT-qPCR in marine bivalve ecotoxicology: Systematic review and case study using copper treated primary Ruditapes philippinarum hemocytes. Aquat Toxicol 185, 86-94.
  2. Donaghy L, Lambert C, Choi KS, Soudant P (2009) Hemocytes of the carpet shell clam (Ruditapes decussatus) and the Manila clam (Ruditapes philippinarum): Current knowledge and future prospects. Aquaculture 297, 10-24.