Difference between revisions of "Saccharomyces cerevisiae"

From ICG
Jump to navigation Jump to search
Line 92: Line 92:
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:ALG]] [[Category:eIF]] [[Category:TBP]] [[Category:Ubiquitin]]
 
[[Category:ALG]] [[Category:eIF]] [[Category:TBP]] [[Category:Ubiquitin]]
 +
[[Category:Various Physiological States]]

Revision as of 14:54, 21 June 2017

Description

Saccharomyces cerevisiae SEM.jpg
  • Saccharomyces cerevisiae is a species of yeast. It has been instrumental to winemaking, baking, and brewing since ancient times. It is believed to have been originally isolated from the skin of grapes (one can see the yeast as a component of the thin white film on the skins of some dark-colored fruits such as plums.
  • it exists among the waxes of the cuticle). It is one of the most intensively studied eukaryotic model organisms in molecular and cell biology, much like Escherichia coli as the model bacterium. It is the microorganism behind the most common type of fermentation. S. cerevisiae cells are round to ovoid, 5–10 μm in diameter. It reproduces by a division process known as budding.
  • Saccharomyces cerevisiae is the main microorganism responsible for the fermentation of wine[1][2].

Various Physiological States

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ALG9[1] alpha-1,2-mannosyltransferase
  • Universal reference genes
NA
  • F:CACGGATAGTGGCTTTGGTGAACAATTAC
  • R:TATGATTATCTGGCAGCAGGAAAGAACTTGGG
93 56 SYBR
TAF10[1] TATA-box binding protein associated factor 10 
  • Universal reference genes
NA
  • F:ATATTCCAGGATCAGGTCTTCCGTAGC
  • R:GTAGTCTTCTCATTCTGTTGATGTTGTTGTTG
96 56 SYBR
TFC1[1] transcription factor TFIIIC subunit
  • Universal reference genes
NA
  • F:GCTGGCACTCATATCTTATCGTTTCACAATGG
  • R:GAACCTGCTGTCAATACCGCCTGGAG
91 56 SYBR
UBC6[1] E2 ubiquitin-conjugating protein
  • Universal reference genes
NA
  • F:GATACTTGGAATCCTGGCTGGTCTGTCTC
  • R:AAAGGGTCTTCTGTTTCATCACCTGTATTTGC
84 56 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Jean-Luc Parrou
  • Email: Jean-Luc.Parrou@insa-toulouse.fr
  • Institution: CNRS, UMR5504, F-31400 Toulouse, France

Citation Statistics

Cited by 215 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 Teste M A, Duquenne M, François J M, et al. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae[J]. BMC molecular biology, 2009, 10(1): 99.
  2. Alonso-del-Real J, Lairón-Peris M, Barrio E, Querol A. Effect of Temperature on the Prevalence of Saccharomyces Non cerevisiae Species against a S. cerevisiae Wine Strain in Wine Fermentation: Competition, Physiological Fitness, and Influence in Final Wine Composition. Frontiers in Microbiology. 2017;8:150. doi:10.3389/fmicb.2017.00150.